ID: 1084444079

View in Genome Browser
Species Human (GRCh38)
Location 11:69193341-69193363
Sequence AGCCAAATGGGGCATTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084444069_1084444079 -5 Left 1084444069 11:69193323-69193345 CCCAGAGGCCCACCCACCAGCCA No data
Right 1084444079 11:69193341-69193363 AGCCAAATGGGGCATTTAATTGG No data
1084444070_1084444079 -6 Left 1084444070 11:69193324-69193346 CCAGAGGCCCACCCACCAGCCAA No data
Right 1084444079 11:69193341-69193363 AGCCAAATGGGGCATTTAATTGG No data
1084444068_1084444079 -1 Left 1084444068 11:69193319-69193341 CCAGCCCAGAGGCCCACCCACCA No data
Right 1084444079 11:69193341-69193363 AGCCAAATGGGGCATTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084444079 Original CRISPR AGCCAAATGGGGCATTTAAT TGG Intergenic
No off target data available for this crispr