ID: 1084444827

View in Genome Browser
Species Human (GRCh38)
Location 11:69197395-69197417
Sequence CCTAACATGCTCCCTTGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084444827_1084444832 -5 Left 1084444827 11:69197395-69197417 CCTAGCCAAGGGAGCATGTTAGG No data
Right 1084444832 11:69197413-69197435 TTAGGAAGCCAGGCCAATGGAGG No data
1084444827_1084444831 -8 Left 1084444827 11:69197395-69197417 CCTAGCCAAGGGAGCATGTTAGG No data
Right 1084444831 11:69197410-69197432 ATGTTAGGAAGCCAGGCCAATGG No data
1084444827_1084444836 11 Left 1084444827 11:69197395-69197417 CCTAGCCAAGGGAGCATGTTAGG No data
Right 1084444836 11:69197429-69197451 ATGGAGGGATAATTTACATGCGG No data
1084444827_1084444833 -4 Left 1084444827 11:69197395-69197417 CCTAGCCAAGGGAGCATGTTAGG No data
Right 1084444833 11:69197414-69197436 TAGGAAGCCAGGCCAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084444827 Original CRISPR CCTAACATGCTCCCTTGGCT AGG (reversed) Intergenic
No off target data available for this crispr