ID: 1084447006

View in Genome Browser
Species Human (GRCh38)
Location 11:69209569-69209591
Sequence ACGGGTGTGGAGCAGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084447006_1084447020 23 Left 1084447006 11:69209569-69209591 CCCGGGGCCTGCTCCACACCCGT No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447006_1084447019 19 Left 1084447006 11:69209569-69209591 CCCGGGGCCTGCTCCACACCCGT No data
Right 1084447019 11:69209611-69209633 CAAGAGCCTCCACCCCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084447006 Original CRISPR ACGGGTGTGGAGCAGGCCCC GGG (reversed) Intergenic