ID: 1084447020

View in Genome Browser
Species Human (GRCh38)
Location 11:69209615-69209637
Sequence AGCCTCCACCCCTGAATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084447015_1084447020 4 Left 1084447015 11:69209588-69209610 CCGTGGGCTCCTGGGCGTGCACC No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447006_1084447020 23 Left 1084447006 11:69209569-69209591 CCCGGGGCCTGCTCCACACCCGT No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447013_1084447020 10 Left 1084447013 11:69209582-69209604 CCACACCCGTGGGCTCCTGGGCG No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447016_1084447020 -5 Left 1084447016 11:69209597-69209619 CCTGGGCGTGCACCCAAGAGCCT No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447014_1084447020 5 Left 1084447014 11:69209587-69209609 CCCGTGGGCTCCTGGGCGTGCAC No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447007_1084447020 22 Left 1084447007 11:69209570-69209592 CCGGGGCCTGCTCCACACCCGTG No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data
1084447010_1084447020 16 Left 1084447010 11:69209576-69209598 CCTGCTCCACACCCGTGGGCTCC No data
Right 1084447020 11:69209615-69209637 AGCCTCCACCCCTGAATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084447020 Original CRISPR AGCCTCCACCCCTGAATGGC TGG Intergenic