ID: 1084447118

View in Genome Browser
Species Human (GRCh38)
Location 11:69210096-69210118
Sequence GGGTGTGCCCGCGGAGTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084447111_1084447118 23 Left 1084447111 11:69210050-69210072 CCTCTGTGGACAGCTGGATGCAC No data
Right 1084447118 11:69210096-69210118 GGGTGTGCCCGCGGAGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084447118 Original CRISPR GGGTGTGCCCGCGGAGTCGC AGG Intergenic
No off target data available for this crispr