ID: 1084447578

View in Genome Browser
Species Human (GRCh38)
Location 11:69212699-69212721
Sequence ACGGTTCCTTCAGGTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084447578_1084447585 4 Left 1084447578 11:69212699-69212721 CCAGGCCCACCTGAAGGAACCGT No data
Right 1084447585 11:69212726-69212748 CTCTTTACGGACTGACCCCAAGG No data
1084447578_1084447590 22 Left 1084447578 11:69212699-69212721 CCAGGCCCACCTGAAGGAACCGT No data
Right 1084447590 11:69212744-69212766 CAAGGTTTGCCCATGCTTGGAGG No data
1084447578_1084447582 -9 Left 1084447578 11:69212699-69212721 CCAGGCCCACCTGAAGGAACCGT No data
Right 1084447582 11:69212713-69212735 AGGAACCGTGCCTCTCTTTACGG No data
1084447578_1084447587 19 Left 1084447578 11:69212699-69212721 CCAGGCCCACCTGAAGGAACCGT No data
Right 1084447587 11:69212741-69212763 CCCCAAGGTTTGCCCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084447578 Original CRISPR ACGGTTCCTTCAGGTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr