ID: 1084447743

View in Genome Browser
Species Human (GRCh38)
Location 11:69213508-69213530
Sequence GACTCACTGTCCCACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084447737_1084447743 17 Left 1084447737 11:69213468-69213490 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1084447743 11:69213508-69213530 GACTCACTGTCCCACGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084447743 Original CRISPR GACTCACTGTCCCACGGGGC TGG Intergenic
No off target data available for this crispr