ID: 1084448860

View in Genome Browser
Species Human (GRCh38)
Location 11:69220796-69220818
Sequence CAGCCCACGAGGGCTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084448860_1084448867 -7 Left 1084448860 11:69220796-69220818 CCACCCAGAGCCCTCGTGGGCTG No data
Right 1084448867 11:69220812-69220834 TGGGCTGGGCTCCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084448860 Original CRISPR CAGCCCACGAGGGCTCTGGG TGG (reversed) Intergenic
No off target data available for this crispr