ID: 1084449428

View in Genome Browser
Species Human (GRCh38)
Location 11:69227029-69227051
Sequence GTTGATAAGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449420_1084449428 25 Left 1084449420 11:69226981-69227003 CCCAAACTAATCTGGAGTGGTGT No data
Right 1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG No data
1084449418_1084449428 27 Left 1084449418 11:69226979-69227001 CCCCCAAACTAATCTGGAGTGGT No data
Right 1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG No data
1084449419_1084449428 26 Left 1084449419 11:69226980-69227002 CCCCAAACTAATCTGGAGTGGTG No data
Right 1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG No data
1084449421_1084449428 24 Left 1084449421 11:69226982-69227004 CCAAACTAATCTGGAGTGGTGTA No data
Right 1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449428 Original CRISPR GTTGATAAGCAGAATGTGGA AGG Intergenic
No off target data available for this crispr