ID: 1084449604

View in Genome Browser
Species Human (GRCh38)
Location 11:69228223-69228245
Sequence TGGAATAATGATGATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449600_1084449604 4 Left 1084449600 11:69228196-69228218 CCATGATGGGGATTATCCTCTTC No data
Right 1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449604 Original CRISPR TGGAATAATGATGATGAGGA TGG Intergenic
No off target data available for this crispr