ID: 1084449823

View in Genome Browser
Species Human (GRCh38)
Location 11:69229876-69229898
Sequence ATGCATGAAGCTGGAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449823_1084449825 -2 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449825 11:69229897-69229919 ATCTCTGCAGCATTACCAACTGG No data
1084449823_1084449828 15 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449828 11:69229914-69229936 AACTGGATACACTAGGCAAAAGG No data
1084449823_1084449830 30 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data
1084449823_1084449829 29 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449829 11:69229928-69229950 GGCAAAAGGCCTACCTGACATGG No data
1084449823_1084449826 8 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449826 11:69229907-69229929 CATTACCAACTGGATACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449823 Original CRISPR ATGCATGAAGCTGGAGTCAG AGG (reversed) Intergenic
No off target data available for this crispr