ID: 1084449824

View in Genome Browser
Species Human (GRCh38)
Location 11:69229885-69229907
Sequence GCTGCAGAGATGCATGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449824_1084449826 -1 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449826 11:69229907-69229929 CATTACCAACTGGATACACTAGG No data
1084449824_1084449832 28 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449832 11:69229936-69229958 GCCTACCTGACATGGGGAGATGG No data
1084449824_1084449830 21 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data
1084449824_1084449828 6 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449828 11:69229914-69229936 AACTGGATACACTAGGCAAAAGG No data
1084449824_1084449829 20 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449829 11:69229928-69229950 GGCAAAAGGCCTACCTGACATGG No data
1084449824_1084449831 22 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449831 11:69229930-69229952 CAAAAGGCCTACCTGACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449824 Original CRISPR GCTGCAGAGATGCATGAAGC TGG (reversed) Intergenic
No off target data available for this crispr