ID: 1084449827

View in Genome Browser
Species Human (GRCh38)
Location 11:69229912-69229934
Sequence TTTTGCCTAGTGTATCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449827_1084449830 -6 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data
1084449827_1084449831 -5 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449831 11:69229930-69229952 CAAAAGGCCTACCTGACATGGGG No data
1084449827_1084449834 5 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449834 11:69229940-69229962 ACCTGACATGGGGAGATGGCTGG No data
1084449827_1084449829 -7 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449829 11:69229928-69229950 GGCAAAAGGCCTACCTGACATGG No data
1084449827_1084449832 1 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449832 11:69229936-69229958 GCCTACCTGACATGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449827 Original CRISPR TTTTGCCTAGTGTATCCAGT TGG (reversed) Intergenic
No off target data available for this crispr