ID: 1084449828

View in Genome Browser
Species Human (GRCh38)
Location 11:69229914-69229936
Sequence AACTGGATACACTAGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449823_1084449828 15 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449828 11:69229914-69229936 AACTGGATACACTAGGCAAAAGG No data
1084449824_1084449828 6 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449828 11:69229914-69229936 AACTGGATACACTAGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449828 Original CRISPR AACTGGATACACTAGGCAAA AGG Intergenic
No off target data available for this crispr