ID: 1084449830

View in Genome Browser
Species Human (GRCh38)
Location 11:69229929-69229951
Sequence GCAAAAGGCCTACCTGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449824_1084449830 21 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data
1084449823_1084449830 30 Left 1084449823 11:69229876-69229898 CCTCTGACTCCAGCTTCATGCAT No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data
1084449827_1084449830 -6 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449830 11:69229929-69229951 GCAAAAGGCCTACCTGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449830 Original CRISPR GCAAAAGGCCTACCTGACAT GGG Intergenic
No off target data available for this crispr