ID: 1084449832

View in Genome Browser
Species Human (GRCh38)
Location 11:69229936-69229958
Sequence GCCTACCTGACATGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449824_1084449832 28 Left 1084449824 11:69229885-69229907 CCAGCTTCATGCATCTCTGCAGC No data
Right 1084449832 11:69229936-69229958 GCCTACCTGACATGGGGAGATGG No data
1084449827_1084449832 1 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449832 11:69229936-69229958 GCCTACCTGACATGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449832 Original CRISPR GCCTACCTGACATGGGGAGA TGG Intergenic
No off target data available for this crispr