ID: 1084449834

View in Genome Browser
Species Human (GRCh38)
Location 11:69229940-69229962
Sequence ACCTGACATGGGGAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084449827_1084449834 5 Left 1084449827 11:69229912-69229934 CCAACTGGATACACTAGGCAAAA No data
Right 1084449834 11:69229940-69229962 ACCTGACATGGGGAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084449834 Original CRISPR ACCTGACATGGGGAGATGGC TGG Intergenic
No off target data available for this crispr