ID: 1084450304

View in Genome Browser
Species Human (GRCh38)
Location 11:69232874-69232896
Sequence GCCCCTCCATCCTCCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084450304_1084450307 3 Left 1084450304 11:69232874-69232896 CCCAGGTGGGAGGATGGAGGGGC No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084450304 Original CRISPR GCCCCTCCATCCTCCCACCT GGG (reversed) Intergenic
No off target data available for this crispr