ID: 1084450307

View in Genome Browser
Species Human (GRCh38)
Location 11:69232900-69232922
Sequence TCCTCTTGCCTGCTCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084450300_1084450307 8 Left 1084450300 11:69232869-69232891 CCAGACCCAGGTGGGAGGATGGA No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data
1084450304_1084450307 3 Left 1084450304 11:69232874-69232896 CCCAGGTGGGAGGATGGAGGGGC No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data
1084450298_1084450307 9 Left 1084450298 11:69232868-69232890 CCCAGACCCAGGTGGGAGGATGG No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data
1084450305_1084450307 2 Left 1084450305 11:69232875-69232897 CCAGGTGGGAGGATGGAGGGGCT No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data
1084450297_1084450307 10 Left 1084450297 11:69232867-69232889 CCCCAGACCCAGGTGGGAGGATG No data
Right 1084450307 11:69232900-69232922 TCCTCTTGCCTGCTCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084450307 Original CRISPR TCCTCTTGCCTGCTCTCACC AGG Intergenic
No off target data available for this crispr