ID: 1084451607

View in Genome Browser
Species Human (GRCh38)
Location 11:69242385-69242407
Sequence GGTGAGGCTGGGAACTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084451607_1084451614 27 Left 1084451607 11:69242385-69242407 CCACTCCAGTTCCCAGCCTCACC No data
Right 1084451614 11:69242435-69242457 CCTGCTTTCACTCAAGACCTTGG No data
1084451607_1084451615 28 Left 1084451607 11:69242385-69242407 CCACTCCAGTTCCCAGCCTCACC No data
Right 1084451615 11:69242436-69242458 CTGCTTTCACTCAAGACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084451607 Original CRISPR GGTGAGGCTGGGAACTGGAG TGG (reversed) Intergenic
No off target data available for this crispr