ID: 1084454812

View in Genome Browser
Species Human (GRCh38)
Location 11:69262337-69262359
Sequence TCCTGGGCTCCTCTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084454803_1084454812 14 Left 1084454803 11:69262300-69262322 CCAGGTGCCTTCAGCTAAGGGCC No data
Right 1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG No data
1084454806_1084454812 -7 Left 1084454806 11:69262321-69262343 CCTGTGACTGCTCCCATCCTGGG No data
Right 1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG No data
1084454799_1084454812 20 Left 1084454799 11:69262294-69262316 CCCTGGCCAGGTGCCTTCAGCTA No data
Right 1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG No data
1084454804_1084454812 7 Left 1084454804 11:69262307-69262329 CCTTCAGCTAAGGGCCTGTGACT No data
Right 1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG No data
1084454800_1084454812 19 Left 1084454800 11:69262295-69262317 CCTGGCCAGGTGCCTTCAGCTAA No data
Right 1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084454812 Original CRISPR TCCTGGGCTCCTCTCTAGGG AGG Intergenic
No off target data available for this crispr