ID: 1084455666

View in Genome Browser
Species Human (GRCh38)
Location 11:69266816-69266838
Sequence CTTTCTCTGCACCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084455666_1084455672 17 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455672 11:69266856-69266878 TTAGACCAAGGGTCCCTAACTGG No data
1084455666_1084455669 -6 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455669 11:69266833-69266855 AGAAAGCATTTAATCAACGTTGG No data
1084455666_1084455674 24 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455674 11:69266863-69266885 AAGGGTCCCTAACTGGTCCGTGG No data
1084455666_1084455670 5 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455670 11:69266844-69266866 AATCAACGTTGGTTAGACCAAGG No data
1084455666_1084455671 6 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455671 11:69266845-69266867 ATCAACGTTGGTTAGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084455666 Original CRISPR CTTTCTCTGCACCAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr