ID: 1084455668

View in Genome Browser
Species Human (GRCh38)
Location 11:69266823-69266845
Sequence TTAAATGCTTTCTCTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084455668_1084455674 17 Left 1084455668 11:69266823-69266845 CCTGGTGCAGAGAAAGCATTTAA No data
Right 1084455674 11:69266863-69266885 AAGGGTCCCTAACTGGTCCGTGG No data
1084455668_1084455671 -1 Left 1084455668 11:69266823-69266845 CCTGGTGCAGAGAAAGCATTTAA No data
Right 1084455671 11:69266845-69266867 ATCAACGTTGGTTAGACCAAGGG No data
1084455668_1084455670 -2 Left 1084455668 11:69266823-69266845 CCTGGTGCAGAGAAAGCATTTAA No data
Right 1084455670 11:69266844-69266866 AATCAACGTTGGTTAGACCAAGG No data
1084455668_1084455672 10 Left 1084455668 11:69266823-69266845 CCTGGTGCAGAGAAAGCATTTAA No data
Right 1084455672 11:69266856-69266878 TTAGACCAAGGGTCCCTAACTGG No data
1084455668_1084455677 26 Left 1084455668 11:69266823-69266845 CCTGGTGCAGAGAAAGCATTTAA No data
Right 1084455677 11:69266872-69266894 TAACTGGTCCGTGGCCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084455668 Original CRISPR TTAAATGCTTTCTCTGCACC AGG (reversed) Intergenic
No off target data available for this crispr