ID: 1084455669

View in Genome Browser
Species Human (GRCh38)
Location 11:69266833-69266855
Sequence AGAAAGCATTTAATCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084455667_1084455669 -7 Left 1084455667 11:69266817-69266839 CCTGCACCTGGTGCAGAGAAAGC No data
Right 1084455669 11:69266833-69266855 AGAAAGCATTTAATCAACGTTGG No data
1084455665_1084455669 -5 Left 1084455665 11:69266815-69266837 CCCCTGCACCTGGTGCAGAGAAA No data
Right 1084455669 11:69266833-69266855 AGAAAGCATTTAATCAACGTTGG No data
1084455666_1084455669 -6 Left 1084455666 11:69266816-69266838 CCCTGCACCTGGTGCAGAGAAAG No data
Right 1084455669 11:69266833-69266855 AGAAAGCATTTAATCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084455669 Original CRISPR AGAAAGCATTTAATCAACGT TGG Intergenic
No off target data available for this crispr