ID: 1084456193

View in Genome Browser
Species Human (GRCh38)
Location 11:69269428-69269450
Sequence GACCACATGCTGCCTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084456193_1084456195 -4 Left 1084456193 11:69269428-69269450 CCAGTCAGAGGCAGCATGTGGTC No data
Right 1084456195 11:69269447-69269469 GGTCTCGATGGCTGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084456193 Original CRISPR GACCACATGCTGCCTCTGAC TGG (reversed) Intergenic
No off target data available for this crispr