ID: 1084457473

View in Genome Browser
Species Human (GRCh38)
Location 11:69276640-69276662
Sequence CTTGAGAGGCAGAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084457473_1084457479 -3 Left 1084457473 11:69276640-69276662 CCCTCCAGCTTCTGCCTCTCAAG No data
Right 1084457479 11:69276660-69276682 AAGTAGCCCAGACTAGAGGTGGG No data
1084457473_1084457478 -4 Left 1084457473 11:69276640-69276662 CCCTCCAGCTTCTGCCTCTCAAG No data
Right 1084457478 11:69276659-69276681 CAAGTAGCCCAGACTAGAGGTGG No data
1084457473_1084457477 -7 Left 1084457473 11:69276640-69276662 CCCTCCAGCTTCTGCCTCTCAAG No data
Right 1084457477 11:69276656-69276678 TCTCAAGTAGCCCAGACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084457473 Original CRISPR CTTGAGAGGCAGAAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr