ID: 1084458310

View in Genome Browser
Species Human (GRCh38)
Location 11:69281812-69281834
Sequence TTTGGTTGCTCTGGAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084458310_1084458314 -7 Left 1084458310 11:69281812-69281834 CCCTCTCTTCCAGAGCAACCAAA No data
Right 1084458314 11:69281828-69281850 AACCAAATCCCAGTCTCTGGAGG No data
1084458310_1084458319 30 Left 1084458310 11:69281812-69281834 CCCTCTCTTCCAGAGCAACCAAA No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458310_1084458313 -10 Left 1084458310 11:69281812-69281834 CCCTCTCTTCCAGAGCAACCAAA No data
Right 1084458313 11:69281825-69281847 AGCAACCAAATCCCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084458310 Original CRISPR TTTGGTTGCTCTGGAAGAGA GGG (reversed) Intergenic
No off target data available for this crispr