ID: 1084458311

View in Genome Browser
Species Human (GRCh38)
Location 11:69281813-69281835
Sequence ATTTGGTTGCTCTGGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084458311_1084458314 -8 Left 1084458311 11:69281813-69281835 CCTCTCTTCCAGAGCAACCAAAT No data
Right 1084458314 11:69281828-69281850 AACCAAATCCCAGTCTCTGGAGG No data
1084458311_1084458319 29 Left 1084458311 11:69281813-69281835 CCTCTCTTCCAGAGCAACCAAAT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084458311 Original CRISPR ATTTGGTTGCTCTGGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr