ID: 1084458316

View in Genome Browser
Species Human (GRCh38)
Location 11:69281836-69281858
Sequence ATCAAAAGCCTCCAGAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084458316_1084458319 6 Left 1084458316 11:69281836-69281858 CCCAGTCTCTGGAGGCTTTTGAT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084458316 Original CRISPR ATCAAAAGCCTCCAGAGACT GGG (reversed) Intergenic
No off target data available for this crispr