ID: 1084458317

View in Genome Browser
Species Human (GRCh38)
Location 11:69281837-69281859
Sequence CATCAAAAGCCTCCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084458317_1084458319 5 Left 1084458317 11:69281837-69281859 CCAGTCTCTGGAGGCTTTTGATG No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084458317 Original CRISPR CATCAAAAGCCTCCAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr