ID: 1084458319

View in Genome Browser
Species Human (GRCh38)
Location 11:69281865-69281887
Sequence AACTCTGTGTGAGTGACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084458317_1084458319 5 Left 1084458317 11:69281837-69281859 CCAGTCTCTGGAGGCTTTTGATG No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458316_1084458319 6 Left 1084458316 11:69281836-69281858 CCCAGTCTCTGGAGGCTTTTGAT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458311_1084458319 29 Left 1084458311 11:69281813-69281835 CCTCTCTTCCAGAGCAACCAAAT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458315_1084458319 12 Left 1084458315 11:69281830-69281852 CCAAATCCCAGTCTCTGGAGGCT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458310_1084458319 30 Left 1084458310 11:69281812-69281834 CCCTCTCTTCCAGAGCAACCAAA No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data
1084458312_1084458319 21 Left 1084458312 11:69281821-69281843 CCAGAGCAACCAAATCCCAGTCT No data
Right 1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084458319 Original CRISPR AACTCTGTGTGAGTGACCTC TGG Intergenic
No off target data available for this crispr