ID: 1084459638

View in Genome Browser
Species Human (GRCh38)
Location 11:69289307-69289329
Sequence GGTACCTATTTCAGTGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084459628_1084459638 29 Left 1084459628 11:69289255-69289277 CCTTGCGGGAGAAATTCCTACTT No data
Right 1084459638 11:69289307-69289329 GGTACCTATTTCAGTGCTATAGG No data
1084459632_1084459638 13 Left 1084459632 11:69289271-69289293 CCTACTTGGGGTGCCAGCCAGCA No data
Right 1084459638 11:69289307-69289329 GGTACCTATTTCAGTGCTATAGG No data
1084459635_1084459638 0 Left 1084459635 11:69289284-69289306 CCAGCCAGCAAGGCAGAGAGGCA No data
Right 1084459638 11:69289307-69289329 GGTACCTATTTCAGTGCTATAGG No data
1084459637_1084459638 -4 Left 1084459637 11:69289288-69289310 CCAGCAAGGCAGAGAGGCAGGTA No data
Right 1084459638 11:69289307-69289329 GGTACCTATTTCAGTGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084459638 Original CRISPR GGTACCTATTTCAGTGCTAT AGG Intergenic
No off target data available for this crispr