ID: 1084461027

View in Genome Browser
Species Human (GRCh38)
Location 11:69296677-69296699
Sequence GAAAATGACCAGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084461027_1084461036 29 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461036 11:69296729-69296751 AAGTTCAGCTCCAGCCGACTGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1084461027_1084461034 0 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461034 11:69296700-69296722 TCAGCTGGTTAGAGGCTGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 236
1084461027_1084461033 -3 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461033 11:69296697-69296719 TTCTCAGCTGGTTAGAGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 165
1084461027_1084461032 -4 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461032 11:69296696-69296718 TTTCTCAGCTGGTTAGAGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 204
1084461027_1084461037 30 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461037 11:69296730-69296752 AGTTCAGCTCCAGCCGACTGGGG 0: 1
1: 0
2: 0
3: 12
4: 92
1084461027_1084461031 -8 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461031 11:69296692-69296714 TCATTTTCTCAGCTGGTTAGAGG 0: 1
1: 0
2: 0
3: 23
4: 232
1084461027_1084461035 28 Left 1084461027 11:69296677-69296699 CCCAGCTCCTTCTGGTCATTTTC 0: 1
1: 0
2: 3
3: 25
4: 325
Right 1084461035 11:69296728-69296750 CAAGTTCAGCTCCAGCCGACTGG 0: 1
1: 0
2: 2
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084461027 Original CRISPR GAAAATGACCAGAAGGAGCT GGG (reversed) Exonic
900323749 1:2097357-2097379 GGAAAAGTCCAGAATGAGCTGGG + Intronic
901023782 1:6268618-6268640 GAACTGGACCAGAAGGAGCATGG - Intronic
902922378 1:19674161-19674183 GAAAATGACCCGGAAGGGCTAGG - Intronic
903125009 1:21241832-21241854 GAAAATCTCCAAAAGGAGCGAGG + Intronic
903373835 1:22853596-22853618 AAGAAGGACAAGAAGGAGCTGGG + Intronic
903516690 1:23916006-23916028 AAAGAAGACCAGAAGGAGCTGGG + Intergenic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
904180933 1:28666219-28666241 GAAAAATACAAAAAGGAGCTGGG + Intergenic
905397366 1:37675463-37675485 GAAAATGATAAGAAGGGGCCAGG + Intergenic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
906962920 1:50430350-50430372 GGAAATGACCAGGAGGAGGGAGG + Intergenic
907379939 1:54078610-54078632 GGAAATGTCCAGCAGGAGGTTGG + Intronic
908465318 1:64387853-64387875 GCAAATGGCCAGAAGCTGCTGGG + Intergenic
910046701 1:82926151-82926173 GAAATTGAACAGAAGGGGCCAGG - Intergenic
911339508 1:96619570-96619592 GAAAATGATTAGAAGAAGATAGG - Intergenic
911766937 1:101688601-101688623 GCTAATGACAAGAATGAGCTTGG + Intergenic
912984444 1:114413261-114413283 GAAAAAGTCCAAAAGTAGCTGGG + Intronic
913427580 1:118751186-118751208 GAAAATGACAATAAGGAGGATGG + Intergenic
917034071 1:170726949-170726971 GAAAGTGATCAGAATGAACTTGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918104477 1:181404791-181404813 GAATCTGACCAGAAGGGGCCAGG + Intergenic
919441658 1:197641293-197641315 AAAAATGAGGAGGAGGAGCTGGG + Intronic
920030735 1:203036007-203036029 TAAAATGACCAGGAGGATTTGGG + Intronic
920681586 1:208077240-208077262 GAAAAGTACCAGCAGGAGATTGG + Intronic
922120017 1:222656498-222656520 GAAAATGACGAAAGGCAGCTAGG - Intronic
922459032 1:225800684-225800706 GAGGATGACCGAAAGGAGCTCGG - Intergenic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
923152801 1:231249039-231249061 GAAAAGGATCAGAATCAGCTGGG - Intronic
924088135 1:240475399-240475421 GAAAATGACCAGAAGATCTTTGG - Intergenic
924727071 1:246681002-246681024 GAAAGAGACCAGATGGACCTTGG - Intergenic
924817681 1:247457026-247457048 GAAGAGGAGGAGAAGGAGCTGGG + Intergenic
1062856592 10:782883-782905 GAAAATGACCAGGAGTAGAGAGG - Intergenic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1064263327 10:13803921-13803943 GCAAATGACCGGAGGGAGCTGGG - Intronic
1064299898 10:14114204-14114226 GAAAATAACCAAAAGGAATTGGG - Intronic
1064423901 10:15213498-15213520 GAAAAGGCCCTGATGGAGCTTGG - Exonic
1068630815 10:59295510-59295532 GGCAATGACCTGAAGAAGCTGGG + Intronic
1068885615 10:62093635-62093657 AAAAAAGACGAGAAGGAACTGGG - Exonic
1068973695 10:62985557-62985579 GAAAAAAACCAGAAGGATATGGG - Intergenic
1069187016 10:65436243-65436265 GAAAAAGAACAGAATGAACTTGG + Intergenic
1069852369 10:71417902-71417924 GAAAATAACTGGAATGAGCTGGG - Intronic
1070156195 10:73837018-73837040 GAAAAAGACCAAAAGGAGAGTGG + Intronic
1070599083 10:77853379-77853401 GAGGAGGACCAGAAGGAGATCGG - Exonic
1070720319 10:78752463-78752485 GACCATGACCAGGAGGAGCCGGG + Intergenic
1071437671 10:85662345-85662367 CAAAAGGACCAGAGGGTGCTTGG + Intronic
1074448145 10:113537364-113537386 TAAAATGACAAGAATTAGCTGGG + Intergenic
1074708172 10:116154556-116154578 GAAAGTGACTAGAAGGAGTTAGG + Intronic
1075258787 10:120945418-120945440 GTAAAGGCCAAGAAGGAGCTAGG - Intergenic
1076224694 10:128764746-128764768 GAAAATGCCCAAAAGGTGGTCGG - Intergenic
1076400975 10:130185104-130185126 GAGAAAAGCCAGAAGGAGCTTGG + Intergenic
1077678079 11:4215049-4215071 GAAGATGACCATGAAGAGCTTGG - Intergenic
1077987099 11:7363969-7363991 GAAAATGACAAGCAGTAGCTGGG + Intronic
1078252153 11:9624991-9625013 GCCAATAACCAGAATGAGCTTGG + Intergenic
1078442351 11:11378351-11378373 GGCAATGACCATAAGTAGCTGGG - Intronic
1078614669 11:12854089-12854111 GAAAATCACCAGAAACAGCCAGG - Intronic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1079638777 11:22778541-22778563 GTAAATGATGAGAAGGAGCCAGG + Intronic
1079675084 11:23217120-23217142 GAAATTTCCCACAAGGAGCTGGG + Intergenic
1080459360 11:32439515-32439537 TGAAATGATCAGAAGAAGCTGGG - Intergenic
1080766231 11:35299817-35299839 GAAAAGGATCAGAAGAAGTTTGG + Intronic
1081417456 11:42833271-42833293 GCTTATGACCACAAGGAGCTAGG - Intergenic
1081687498 11:45053214-45053236 GAAAATGCCCAGTAGGATGTTGG - Intergenic
1081918940 11:46754647-46754669 GAAACTGGCCGGAAGAAGCTAGG + Intronic
1083369596 11:62167582-62167604 CAAAAGGACCAGTAGCAGCTGGG + Intergenic
1083683053 11:64360048-64360070 GCAAATGAGGCGAAGGAGCTGGG - Intronic
1083986478 11:66219114-66219136 GAGAAAGACCAGAAGCAGGTGGG + Intronic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1087268538 11:96087226-96087248 GAAAATTAGCAGGAGGAACTTGG - Intronic
1087825898 11:102764432-102764454 GAATATAACCTGAATGAGCTTGG - Intergenic
1088295675 11:108291144-108291166 GAAAATGGCCAGAACCAGGTAGG + Intronic
1088969972 11:114764992-114765014 GAAAAATCCCAGAAGGAGCAGGG - Intergenic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1093126241 12:15331543-15331565 GAAAATGACCACAAAGTACTGGG + Intronic
1093723204 12:22469906-22469928 GAAAATGACCAGAATAAATTGGG - Intronic
1094285247 12:28785222-28785244 GTAAGTGACAAGAAGTAGCTAGG + Intergenic
1094628681 12:32150899-32150921 GAAAATGACAAGAAAATGCTCGG - Intronic
1096325200 12:50654167-50654189 CAAAATTAGCAGAAGGTGCTGGG - Intronic
1096606707 12:52771866-52771888 GAAAATGTCAAGAAGCAGGTGGG - Exonic
1097592492 12:61589883-61589905 GTAAATGATGAGAAAGAGCTTGG - Intergenic
1097680050 12:62640507-62640529 AAAAATGATAAGAATGAGCTGGG + Intergenic
1097721612 12:63027961-63027983 GAAGATGACCTGAAGCAGCTTGG + Intergenic
1100450899 12:94705647-94705669 GAAAATGACCAGGTAGACCTAGG - Intergenic
1100476348 12:94939150-94939172 CATAATGACCAGCATGAGCTGGG - Intronic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1101510121 12:105385376-105385398 GAAAGAGGCCTGAAGGAGCTTGG + Intronic
1102410641 12:112715233-112715255 GCTAATGATGAGAAGGAGCTAGG - Intronic
1103990471 12:124795704-124795726 CAAAATGATCAGGAGGAGTTGGG - Intronic
1104737986 12:131151644-131151666 TAAAAAGACCTGAGGGAGCTGGG + Intergenic
1105617225 13:22029914-22029936 GTGAATTTCCAGAAGGAGCTGGG - Intergenic
1106021506 13:25920160-25920182 GAAAAGGCCGAGAAGGAGTTGGG - Intronic
1106869879 13:34007808-34007830 GAGAATCACTTGAAGGAGCTTGG - Intergenic
1108538376 13:51410914-51410936 GAAAATAAGCACATGGAGCTGGG + Intronic
1110291908 13:73817454-73817476 GGAAATCTCTAGAAGGAGCTGGG - Intronic
1110813152 13:79832655-79832677 GAAAGTTTCCAGAAGGAGATGGG - Intergenic
1110928322 13:81183669-81183691 CAAAATGACCATAAGGAAGTAGG - Intergenic
1112106945 13:96251088-96251110 GAAAATGAGTAGAATGAGCTTGG + Intronic
1114956381 14:27825156-27825178 GAAAATGACCAGAAAAAAGTTGG - Intergenic
1115410252 14:33066145-33066167 GAAAATGAGAAGCAGCAGCTCGG + Intronic
1115699162 14:35932537-35932559 GCCAATGACCTGAGGGAGCTTGG + Intergenic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116857242 14:49963582-49963604 GAAAAAGACAAGAATTAGCTGGG + Intergenic
1119135402 14:72213692-72213714 AAACATGGCTAGAAGGAGCTAGG - Intronic
1119305221 14:73602400-73602422 GTAAATAACCTCAAGGAGCTCGG - Intergenic
1119532620 14:75373645-75373667 GAAAATGAACAGAAATTGCTAGG - Intergenic
1119729019 14:76939425-76939447 GAAAATGAACAGAATGAACAGGG - Intergenic
1119917959 14:78419669-78419691 CACAATCACCAGAAGGGGCTTGG - Intronic
1119969082 14:78949216-78949238 GAAGAGGAGCAGAAGGAACTTGG - Intronic
1120664754 14:87292668-87292690 GAAAATTACTAGGAGGATCTTGG + Intergenic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1121819968 14:96958355-96958377 GAAAATGATAAGCAGGAGCCTGG - Intergenic
1122014159 14:98779314-98779336 GCCAGTGACCAGAAGGAGCATGG - Intergenic
1122690612 14:103530515-103530537 GAAATGGACCAGGAGGAGCTGGG + Intronic
1122758337 14:104000487-104000509 AAAAATGACTAGAAATAGCTGGG + Intronic
1123122699 14:105925403-105925425 GGACATGACCAGGAGGAGCGAGG - Intronic
1123533972 15:21167858-21167880 GGAAATGACCAGTAGGAAATGGG - Intergenic
1124161668 15:27275872-27275894 GACAATGAGCACAAGGAGGTGGG + Intronic
1125120203 15:36147734-36147756 GACAATGACCAAAAGGAGTGGGG + Intergenic
1125351086 15:38768239-38768261 GAGAATGAGCATCAGGAGCTAGG - Intergenic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1127195617 15:56582652-56582674 GGAAATGACCATAGGGAACTAGG - Intergenic
1127905321 15:63372082-63372104 GAAGATGACCGGAAGGAGGCAGG - Intronic
1128907595 15:71482034-71482056 GACTATGGCCAGAAGGAGCAGGG - Intronic
1131151402 15:90049568-90049590 GAGGATGACCTGTAGGAGCTTGG - Intronic
1132161180 15:99544227-99544249 AAAAATTACCAGAATTAGCTGGG + Intergenic
1133399572 16:5474923-5474945 GAAAATGACCATCTTGAGCTTGG + Intergenic
1134388728 16:13798344-13798366 GTACATCACCAGAAGGTGCTTGG + Intergenic
1136041654 16:27584190-27584212 GAAAATGACAGGAAGGAGAAGGG - Intronic
1136713906 16:32261952-32261974 GAGAATGACCAGAAGTACCGGGG + Intergenic
1140572898 16:76129601-76129623 GAAAATGATCTGAAAGATCTAGG - Intergenic
1143001767 17:3799124-3799146 GAAAATGTCCAGGAGATGCTGGG - Intronic
1143146103 17:4776902-4776924 GAAAAAGACCAAACTGAGCTGGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143659903 17:8318426-8318448 GAGAATGCCCAGAAGGCCCTGGG + Exonic
1145262312 17:21361627-21361649 GAGAAAGACCTGAAGGAGGTAGG - Intergenic
1148647493 17:49227510-49227532 GAATGAGACCAGAAGCAGCTGGG + Intronic
1148738014 17:49875715-49875737 CAAGAGGGCCAGAAGGAGCTGGG + Intergenic
1148775240 17:50091550-50091572 GAAAATTAACAGAAGGACCTAGG - Intergenic
1150479994 17:65501844-65501866 GAAAATAACTAGAAGTGGCTGGG + Intergenic
1151332012 17:73415504-73415526 AAAAATGAACAGAACTAGCTTGG - Intronic
1151619219 17:75235188-75235210 GAAAATGACCTGGAGCTGCTCGG - Exonic
1151653254 17:75483133-75483155 GAACATGAGCTGAAGGGGCTCGG + Intronic
1154385425 18:13887928-13887950 GAAAATAAACAGCAGGAGATGGG - Intronic
1154955939 18:21254701-21254723 GAGAATGACCAAAAGAATCTTGG - Intronic
1156194830 18:34762642-34762664 GAAAGGGACCAGAAGAAGCTGGG - Intronic
1156248302 18:35325064-35325086 AAACAAGACCAGAAGGAGCCTGG + Intergenic
1156248475 18:35326997-35327019 GAAACTGACCAGATGGAGAGAGG + Intergenic
1156517717 18:37695189-37695211 GAAAAAGAGAAGAGGGAGCTGGG + Intergenic
1156746836 18:40402630-40402652 GAAAAAGAACAGAAGGAGGAGGG + Intergenic
1157584296 18:48791325-48791347 GAAAATGACTTAAAAGAGCTTGG - Intronic
1158603914 18:58878092-58878114 TAAAATGACAAAAAGTAGCTAGG + Intronic
1159331076 18:66994573-66994595 TAATTTGACCAGAAGGTGCTGGG - Intergenic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1160761105 19:784928-784950 GAAGATGACCAGGAGGAGGAAGG + Intergenic
1162484231 19:10949037-10949059 GAAACTGATCACAAGGACCTAGG + Intergenic
1164050516 19:21582623-21582645 GCCAATGACCTGAATGAGCTTGG + Intergenic
1164573713 19:29392779-29392801 TAAGATGAGCAGAGGGAGCTGGG + Intergenic
1165448727 19:35870398-35870420 GCCAATGAGCACAAGGAGCTTGG + Intronic
1166887398 19:45970669-45970691 AAAAATGACCATAAGGGGCTGGG - Intronic
1167068143 19:47202616-47202638 AAAAATGTCTAGAAGGGGCTGGG + Intronic
1167734233 19:51282109-51282131 CAACGTGACCAGAAGTAGCTTGG + Intergenic
926429691 2:12773384-12773406 TAAAATGACCAGAAGAAAATGGG + Intergenic
927493732 2:23538089-23538111 AAAACAGACCAGAAGGAGCAAGG + Intronic
928172850 2:29014532-29014554 GAAGAGGACCAGAAGGAGATCGG + Exonic
929301464 2:40308509-40308531 GTAAATGACAGGAAGAAGCTTGG + Intronic
934458468 2:94195532-94195554 GGAAATGACCAGTAGGAAATGGG + Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
936877671 2:117212050-117212072 GAAAAGCACAAAAAGGAGCTAGG - Intergenic
937528449 2:122799658-122799680 GGAAACCACCAGAAGAAGCTAGG - Intergenic
938622854 2:133074887-133074909 GAAAATGAAAAGAAAGAGATTGG + Intronic
938649723 2:133370231-133370253 AAATATGACCAGAAAGAGCTTGG + Intronic
941823222 2:169863916-169863938 CAAAATGACATGAAGGAGGTAGG - Intronic
942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG + Intronic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
944128298 2:196318689-196318711 GTACCTGACCAGGAGGAGCTGGG - Exonic
945335756 2:208591155-208591177 GAAAATGACGTGAGGGAGCAAGG - Intronic
945998975 2:216464984-216465006 AAAAATGAACAGAATTAGCTGGG + Intronic
947890031 2:233609382-233609404 GAAGATGACTTGAAGGAGATTGG - Intergenic
948130268 2:235595340-235595362 GAAACTGACCAGAAGCACATAGG + Intronic
1169567470 20:6870773-6870795 GAAACTGGGCAGGAGGAGCTTGG + Intergenic
1169949230 20:11024543-11024565 GAAAATAACCAGAATTATCTGGG - Intergenic
1170938177 20:20827579-20827601 GCAAGTGACAAGAAGAAGCTGGG - Intergenic
1171343879 20:24451280-24451302 GAAATTGACCAGGAGAAGCCTGG - Intergenic
1172353201 20:34260134-34260156 GACAAGGAACAGAAGGAGATTGG - Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1174993189 20:55536007-55536029 GAATATTTCAAGAAGGAGCTTGG - Intergenic
1175274836 20:57761209-57761231 CCAAAGGACCAGAGGGAGCTTGG - Intergenic
1176944865 21:14967255-14967277 GAAAATGGCCAGAAGGATGTTGG - Exonic
1178189264 21:30262127-30262149 GAAAATGACAGGAAAGAGATTGG - Intergenic
1179045895 21:37844767-37844789 GAAAATGGTCAGAAAGAGCAGGG - Intronic
1179466858 21:41581609-41581631 GCAAATGACCACCAGGAGCCAGG + Intergenic
1179534259 21:42041137-42041159 GAGAATGATCAGAAGGTCCTGGG + Intergenic
1179820320 21:43933497-43933519 GAAAATGTCAAGAAGCAGCCAGG - Intronic
1179825207 21:43960843-43960865 GAAAAATCCCAGAAGGGGCTGGG + Intronic
1182452239 22:30428520-30428542 GAGTATGATCAGGAGGAGCTGGG - Exonic
1183485836 22:38087284-38087306 GACAATGACCAAAAGAAGCCAGG + Intronic
1203281691 22_KI270734v1_random:135047-135069 GGAAAGGAGCAGGAGGAGCTGGG - Intergenic
951343152 3:21513344-21513366 CAAAATGACCAGAAGTTGATAGG + Intronic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
951864634 3:27294408-27294430 CAAAATGACATGAAGGAGCCAGG + Intronic
952039850 3:29248975-29248997 AGAAATGGCCAGAAGGAGCTGGG - Intergenic
952895028 3:38072982-38073004 GTAAATCACGAGAAAGAGCTTGG + Intronic
953570830 3:44070261-44070283 GAAAAAAACCAGAAGGCTCTGGG - Intergenic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
954250479 3:49363437-49363459 GAAAATAACCAAAAGAGGCTGGG + Intronic
955862760 3:63349735-63349757 CAAAATGAGTAGAAGGAACTTGG - Intronic
956502685 3:69903799-69903821 GCAAGTGAGCAGAAGGTGCTGGG + Intronic
957550266 3:81695146-81695168 GAAATTGAGAAGAGGGAGCTTGG - Intronic
957798790 3:85047663-85047685 GAAAATGAGGATAAGTAGCTTGG + Intronic
958999957 3:100952064-100952086 GAATATTAGCAGGAGGAGCTGGG - Intronic
959000292 3:100956495-100956517 GCAATTGACCAGATGGAGCCTGG + Intronic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
959352999 3:105291787-105291809 GAAAGTCAGGAGAAGGAGCTGGG - Intergenic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
962049895 3:131802077-131802099 GAACATGACCAGAAGGACTTTGG + Intronic
962989892 3:140568398-140568420 GAAAAACACCAGAAGAAGCTGGG + Exonic
964292800 3:155200000-155200022 GCAAACCACCAGAAGAAGCTAGG + Intergenic
965475479 3:169149864-169149886 GGAAATCATCAGAAGGACCTGGG + Intronic
965608314 3:170518711-170518733 GAGAATGACCAGGATGAACTTGG + Intronic
967478128 3:189944225-189944247 GAAAATGACTAGCATGAACTAGG + Intergenic
967813175 3:193777465-193777487 GAATATGACCTGAATCAGCTAGG - Intergenic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
969704688 4:8785343-8785365 GAAAAGGAGCGGCAGGAGCTGGG + Intergenic
970403352 4:15738917-15738939 GGAAATGAGCATTAGGAGCTAGG - Intergenic
972186911 4:36540590-36540612 GAAAATGATCAGAAAGAGAATGG - Intergenic
973308911 4:48685676-48685698 GAAAATGACCACAGGGAATTGGG + Intronic
973810269 4:54562576-54562598 GGAAATAATCAGAGGGAGCTGGG + Intergenic
975639958 4:76490548-76490570 TAAAAGGACCAGAAGCAGCCGGG - Intronic
976153368 4:82115624-82115646 GAAAATGAAAAGTAGGGGCTTGG - Intergenic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
978188852 4:105890279-105890301 GAAAATGAAAAGGAGGAGATAGG - Intronic
978628093 4:110710604-110710626 GAAACAGACCAGAAGAATCTTGG - Intergenic
979169364 4:117581191-117581213 GAAAATAATTAGAAGGTGCTGGG + Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
983223101 4:165061645-165061667 TAACATAACCAGAAGGATCTGGG + Intergenic
983922808 4:173365688-173365710 AAAACTGACCCAAAGGAGCTAGG + Intergenic
984858591 4:184217191-184217213 GAAAAGGGACAGAAGGAGTTTGG + Intronic
984912016 4:184682641-184682663 AAAAATTACCTGAAGTAGCTGGG - Intronic
985698089 5:1353212-1353234 GAAAGTCACCAGAAGGAGAGTGG - Intergenic
986315252 5:6582841-6582863 AAAAAAGACCAGACGGACCTGGG - Intergenic
987154184 5:15071376-15071398 GAAAATGACAGGAAGGAGAGAGG + Intergenic
989132042 5:38116608-38116630 GGAGATGACTGGAAGGAGCTAGG + Intergenic
989778444 5:45236390-45236412 TGAAATGACCATAGGGAGCTAGG - Intergenic
990644307 5:57826489-57826511 AAAAATGGCAAGAAGCAGCTGGG - Intergenic
992332746 5:75733916-75733938 CAAAAAGACCTGAGGGAGCTTGG - Intergenic
993117899 5:83739638-83739660 AAAAATGACTAGAATGAGGTAGG - Intergenic
993705670 5:91166967-91166989 CAAAAAGACTAGAAGTAGCTGGG - Intergenic
994929883 5:106168010-106168032 GAAAATAACAGGAAGGAGCAAGG + Intergenic
995372602 5:111436031-111436053 AAAAATGAACAGAAAAAGCTAGG - Intronic
996031780 5:118713194-118713216 GAAACTGACCAGCAGTTGCTAGG - Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
996988135 5:129593295-129593317 GCACATGACCAGAAAGAACTTGG - Intronic
997246835 5:132356911-132356933 GAAAAAGACCAGAAGAAAGTAGG + Intergenic
997848969 5:137313805-137313827 GTATATGATCAGAAAGAGCTAGG - Intronic
997945621 5:138198118-138198140 GAAAATAACCACAATTAGCTAGG - Intronic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
998992548 5:147833873-147833895 GGAAATGACCAGATTGAGCAAGG - Intergenic
999228691 5:150048690-150048712 GAAAATAACTAGGGGGAGCTTGG + Intronic
999807076 5:155091986-155092008 GCAAATGACCAGTAGTGGCTAGG - Intergenic
1000774748 5:165405762-165405784 GAAGTTGACCAGGAGGAGTTTGG - Intergenic
1001072799 5:168601358-168601380 GCAAAGGCCCTGAAGGAGCTTGG - Intergenic
1001140645 5:169140946-169140968 GAAGATGACAAGATGGAGATTGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1002661139 5:180791827-180791849 ACCAATGACCGGAAGGAGCTGGG - Exonic
1003311164 6:4971037-4971059 GACAAGGACCAGAAGGAGCCTGG + Intergenic
1003401569 6:5795171-5795193 GAAAATTACCAAAAGGAACTTGG + Intergenic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1005804215 6:29459002-29459024 GAAAAGGACCAGAAGAAACAGGG + Intronic
1005808994 6:29502158-29502180 GGAAATGGAAAGAAGGAGCTGGG + Intergenic
1006352126 6:33528713-33528735 GAAAAAAAACAGAAGGAGCCTGG + Intergenic
1006576027 6:35046927-35046949 GAAAACTACCAGAAGAGGCTGGG - Intronic
1006826422 6:36939294-36939316 GCAGAGGACCAGAAGGAGGTTGG + Intergenic
1007965776 6:46002540-46002562 GAAGAGGACCAGAAGGAAGTGGG - Intronic
1008606835 6:53148818-53148840 GAAAATGACCAGAGCCTGCTGGG - Exonic
1010132065 6:72505895-72505917 GAGAATGAGCAGTAGGAACTAGG + Intergenic
1010242027 6:73625099-73625121 GAAAAAGGCCAGAAGAAGGTTGG - Intronic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1011056163 6:83205624-83205646 GAAAAGCACCAGAAAGAGTTGGG - Intergenic
1012099002 6:95006014-95006036 GAAAAGGACCAGCAAGAGATGGG + Intergenic
1013288274 6:108698884-108698906 GTAAATGCCCAGAATGTGCTGGG + Intergenic
1015225700 6:130854497-130854519 AAAAATGAACATAAGGTGCTAGG + Intronic
1018197066 6:161364514-161364536 GGAAAAGTCCAGAAGGAGCCAGG + Intronic
1018387898 6:163321693-163321715 GGAAATGCCCAGCAGGCGCTGGG - Intergenic
1020910224 7:14120116-14120138 GAAAGGGACCAGAAGAAGTTTGG + Intergenic
1021802452 7:24320772-24320794 CAAAGTGACCAGAAGAGGCTGGG - Intergenic
1021802612 7:24322524-24322546 GAAAGTGACCAAAAGCAACTGGG + Intergenic
1021921769 7:25492453-25492475 GAGGGGGACCAGAAGGAGCTGGG + Intergenic
1022252545 7:28622890-28622912 GAAAAAAACCAGAAGAAGGTGGG - Intronic
1022559385 7:31333549-31333571 GAATTTTACCAGCAGGAGCTTGG + Intergenic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1023874013 7:44277141-44277163 GACAATGAGCAGCAGGGGCTGGG + Intronic
1026171845 7:67960847-67960869 GAAAACGTCCAGAAGGAGCTTGG + Intergenic
1026807926 7:73439312-73439334 GAAAATGTCCAGAAGGAGCATGG + Intergenic
1027399880 7:77796688-77796710 GAAAAAGATCAGAAGGTGCTAGG + Intronic
1027865136 7:83636842-83636864 GAACATGAACAGGAGGAGCTTGG - Intronic
1028006587 7:85577923-85577945 GAAACAGACCATAAGAAGCTTGG + Intergenic
1030569855 7:111209789-111209811 GAAACTGCCCAGAAAGAGGTGGG + Intronic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031233703 7:119144155-119144177 GAAATTGACCAATAGAAGCTGGG - Intergenic
1031638394 7:124130671-124130693 GAAAATTACTAATAGGAGCTTGG + Intergenic
1032203079 7:129837157-129837179 GGAAATGTCCAGCAGCAGCTTGG + Intronic
1032736205 7:134694762-134694784 GAAGATGACCAGAAGAATCTGGG - Intergenic
1035758659 8:2053086-2053108 GAAAATTCCCAGAAGTAGCAGGG - Intronic
1036386119 8:8283291-8283313 TAAAAAGAACAGAAGGAGCCAGG - Intergenic
1036425466 8:8641742-8641764 GAAAGTGAGAAGAAGGGGCTGGG + Intergenic
1037608698 8:20458639-20458661 GAAAATGACTGGAAGGTGATGGG - Intergenic
1037692014 8:21189767-21189789 GAAAATGACCAGAAAGTTTTTGG + Intergenic
1037809643 8:22080015-22080037 GAAGGTGACCAGTAGGAGCTGGG + Intronic
1038535511 8:28350266-28350288 TGCAATGACCAGAAAGAGCTGGG + Intronic
1040711291 8:50192209-50192231 GAACAAAACCAGAAGCAGCTTGG + Intronic
1040806345 8:51401160-51401182 GAAAATGACCAGGGGTAGCAAGG + Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1041716646 8:60938529-60938551 GAAAATGAAGAGGAGGAGATTGG - Intergenic
1042137332 8:65644878-65644900 GAACAGGAGCTGAAGGAGCTCGG + Intronic
1043948764 8:86284278-86284300 GAAAATGAACAGAAGAAAGTGGG + Intronic
1044200126 8:89425095-89425117 GAAAATGTCCAAAATTAGCTTGG - Intergenic
1044557183 8:93575976-93575998 GAAGATGAATAGAAGGAGTTAGG + Intergenic
1045345535 8:101290367-101290389 GAATGTGAGCAGAAGGAACTAGG + Intergenic
1046763013 8:118041113-118041135 GAGAATGACCAGAAGGATCTAGG + Intronic
1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG + Intronic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1052296198 9:26898284-26898306 GAACATGACAACAAGCAGCTAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053280161 9:36815366-36815388 GAAAAGGACCATAAGGCTCTTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058422569 9:104846518-104846540 GAAAATGTCTAGAAGTGGCTGGG + Intronic
1060289292 9:122285621-122285643 GGCAATGATCAGCAGGAGCTGGG - Intronic
1061541570 9:131280305-131280327 GAAAATGACGAGCAGGAGGAAGG - Intergenic
1062682569 9:137789664-137789686 GACTTTGACCGGAAGGAGCTGGG - Intronic
1185724903 X:2411827-2411849 AAAAGTGACCAGAAAAAGCTGGG + Intronic
1187193492 X:17058878-17058900 GAAAATGGCCAGAACCACCTAGG + Intronic
1187429652 X:19210547-19210569 CAAAATGACCAGAGCAAGCTTGG + Intergenic
1187552152 X:20316700-20316722 GCAATTGACTAGATGGAGCTTGG + Intergenic
1187647459 X:21363951-21363973 GAGAAGGACAAGTAGGAGCTGGG - Intergenic
1189305870 X:39986333-39986355 GGAAAAGACCAGAAGGAATTGGG - Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1191825741 X:65363111-65363133 GTAAATCACGAGAAAGAGCTTGG - Intergenic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1194693907 X:97021357-97021379 AAAAATTACCAAAAGGAGCAGGG - Intronic
1196217136 X:113066766-113066788 TTAAATGATCATAAGGAGCTGGG + Intergenic
1196834675 X:119803187-119803209 GAAAATTTCAAGAAGGAGATTGG - Intergenic
1196835833 X:119812960-119812982 GAAAATTTCTAGAAGGAGATTGG - Intergenic
1196837870 X:119829972-119829994 GAAAATTTCAAGAAGGAGATTGG - Intergenic
1199791289 X:151157535-151157557 GAGAAAGAACAGAAAGAGCTTGG + Intergenic
1200170102 X:154066409-154066431 GAAAATGAAAAGACAGAGCTGGG - Intronic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic