ID: 1084462766

View in Genome Browser
Species Human (GRCh38)
Location 11:69305300-69305322
Sequence ATGAAGGCCCAGAGGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084462766_1084462776 17 Left 1084462766 11:69305300-69305322 CCTTTGCCCCTCTGGGCCTTCAT 0: 1
1: 0
2: 4
3: 43
4: 330
Right 1084462776 11:69305340-69305362 GGTGCCTTAATTAAGAGCACGGG 0: 1
1: 0
2: 1
3: 10
4: 94
1084462766_1084462775 16 Left 1084462766 11:69305300-69305322 CCTTTGCCCCTCTGGGCCTTCAT 0: 1
1: 0
2: 4
3: 43
4: 330
Right 1084462775 11:69305339-69305361 TGGTGCCTTAATTAAGAGCACGG 0: 1
1: 1
2: 0
3: 11
4: 136
1084462766_1084462774 -4 Left 1084462766 11:69305300-69305322 CCTTTGCCCCTCTGGGCCTTCAT 0: 1
1: 0
2: 4
3: 43
4: 330
Right 1084462774 11:69305319-69305341 TCATCAGAAGGGAGGCAGTGTGG 0: 1
1: 1
2: 2
3: 36
4: 358
1084462766_1084462778 30 Left 1084462766 11:69305300-69305322 CCTTTGCCCCTCTGGGCCTTCAT 0: 1
1: 0
2: 4
3: 43
4: 330
Right 1084462778 11:69305353-69305375 AGAGCACGGGTTCTGAGCTCAGG 0: 1
1: 0
2: 1
3: 28
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084462766 Original CRISPR ATGAAGGCCCAGAGGGGCAA AGG (reversed) Intronic
900512208 1:3066165-3066187 ATGTAGGCCCAGTGGGGAAAAGG - Intergenic
901488341 1:9581230-9581252 AAGGAGGCCCAGGTGGGCAAAGG + Intronic
901871356 1:12140842-12140864 GAGAAGGCCCAGAGGGGGATGGG - Intronic
902069496 1:13722364-13722386 AGAAAGGCCCAGAGTAGCAAGGG + Intronic
902519542 1:17008398-17008420 ATGGAAGCCCAGAGAGGCAAAGG - Intronic
903133170 1:21292261-21292283 ATGAGGGCCCAGAGTGGGCAGGG - Intronic
903366272 1:22807149-22807171 AAGCAGGCCCAGAGGAGCAGAGG - Intronic
904026973 1:27510104-27510126 GTGAAAGCCCAGAGGGGAGAAGG - Intergenic
904775616 1:32904373-32904395 ATTGAGGCCCAGAGAGGTAAAGG + Intergenic
906073636 1:43035941-43035963 ATGGAGGCCCAGGTGGGCAGAGG + Intergenic
906097634 1:43234981-43235003 ATGAAGGTCTAGAGGGCCAAGGG - Intronic
906511226 1:46411423-46411445 ATCAGGCCCCAGAGGGGCACAGG - Intronic
906642307 1:47448912-47448934 ATGGAGGCCCAGTGGGGATAGGG - Intergenic
906804062 1:48762811-48762833 ATGAAGGCCCAGCTGGTCAGAGG + Intronic
906850325 1:49242029-49242051 ATTAAGGCCACGAGGGGAAAAGG - Intronic
907434350 1:54434725-54434747 ATGATGACCCAGAGGGGGAAGGG + Intergenic
907773465 1:57489066-57489088 TTGGAGGCCCAGAGAGTCAAAGG - Intronic
908383961 1:63622949-63622971 ATGAATGCCCAGAGAGGCTCTGG + Intronic
909943315 1:81635234-81635256 AGGAAGCACCAGAGGGGAAATGG - Intronic
911203538 1:95070299-95070321 ATGAAGACCCAGAGATACAAGGG - Intronic
911533194 1:99070636-99070658 AAGGAGGTCCAGAGGGGCACTGG + Intergenic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
912544985 1:110444246-110444268 AAAAAGGCACAGAAGGGCAAGGG + Intergenic
913451503 1:118995723-118995745 ATGATGACTCTGAGGGGCAAGGG + Intergenic
913983310 1:143543098-143543120 ACTAAGGCCCAAAGGGTCAAGGG + Intergenic
915067647 1:153239771-153239793 ATGAAGGCTCAGAGGAGCTGAGG - Intergenic
915904036 1:159865225-159865247 ATTAAGCCTCAGAGGGTCAAGGG - Intronic
916107123 1:161440691-161440713 AAGGAGGCCCAGAAGGCCAAAGG + Intergenic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
920186566 1:204162977-204162999 ATGAAGGCTCACAGGGACAAAGG + Intronic
920256507 1:204658818-204658840 ATGCAGGCCCACAAGGGCAGGGG - Intronic
920288818 1:204901872-204901894 AAGGTGGCACAGAGGGGCAAAGG + Intronic
920372393 1:205487421-205487443 ATGAGTGCCCAGAGAGGGAAAGG - Intergenic
920857624 1:209675724-209675746 ATGATGGCCCAGAAGCGCAAGGG + Exonic
921011370 1:211145178-211145200 CTGAAGGCTCAGCTGGGCAAAGG + Intergenic
923136304 1:231123193-231123215 GTGAAGGCCTGGAGGGGGAAGGG - Intergenic
923380003 1:233407736-233407758 ATGAGGGGCCAGAGGAGCACTGG + Intergenic
923616900 1:235545704-235545726 ATGTAGGCCCAGAGCAGCAGAGG - Intergenic
923888054 1:238180040-238180062 ATGCAGGCCCAAAGAGGCAAGGG + Intergenic
924827154 1:247551723-247551745 ATGAAGACCCAAAGATGCAAAGG + Intronic
1062895035 10:1096854-1096876 GTGAAGGCTCAGAGAGGAAAGGG + Intronic
1062930073 10:1347089-1347111 GTGCAGGCCCAGAGGGGCCCAGG + Intronic
1065882638 10:30049677-30049699 AAGAAGGACCAGAGAAGCAAGGG + Intronic
1067082856 10:43221438-43221460 ATGAAGGAACAGAGGCCCAAAGG + Intronic
1067294317 10:44966166-44966188 ATTAAGGCCCAGAGAGGAGAAGG + Intronic
1069861724 10:71475770-71475792 ATGCAGGCCCTGAGGGGCGGAGG + Intronic
1070542217 10:77424370-77424392 ATGAAGGCTCAGAGAGGTCAAGG + Intronic
1073054759 10:100692250-100692272 AGGAAGGCTCAGAGGGGAGAGGG - Intergenic
1074871056 10:117576332-117576354 AGGGAGGCCCAGGGGGGCCAAGG - Intergenic
1074919320 10:117991362-117991384 AGGAAGGGGCAGAGGGGCAGAGG + Intergenic
1075534643 10:123260024-123260046 ATGAAGGACCAAATGGGAAACGG + Intergenic
1075590366 10:123686840-123686862 ATTGAGGCCCAGAGAGGGAAAGG - Intronic
1075802455 10:125161338-125161360 ATGAAGGGCCAGGGGAGCAGCGG - Intergenic
1077550310 11:3197289-3197311 ATGAAGGCCCAGGAGGGCCCAGG + Intergenic
1078579156 11:12525496-12525518 AGAAAGGCAGAGAGGGGCAAAGG - Intronic
1079354102 11:19715604-19715626 ATGAAGGGTCAAACGGGCAAAGG - Intronic
1081702996 11:45163675-45163697 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1081766602 11:45615657-45615679 ATGAAGACACACAGGGGCAGAGG - Intergenic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1082095041 11:48122961-48122983 ACGAAGACCCAGAGAGGCAGGGG - Intronic
1083299693 11:61733924-61733946 ACAGAGGCCCAGAGGAGCAAGGG + Intronic
1083597367 11:63924604-63924626 ATGAAGGCCAGGAGGGGCAGTGG - Intergenic
1083607585 11:63987956-63987978 ATGAAAGCCCAGAAGGGGAAGGG + Intronic
1083884519 11:65565569-65565591 ATGAAGGCCTGGAGGGGACAAGG + Intergenic
1084462766 11:69305300-69305322 ATGAAGGCCCAGAGGGGCAAAGG - Intronic
1085336796 11:75702610-75702632 GTGAAGGCCCAGGGTGGAAAGGG - Intergenic
1085664112 11:78397569-78397591 ATGAGGGCACAGAGGTGAAATGG + Intronic
1085726817 11:78961824-78961846 GTGAAGGCCCAGACAGGTAAAGG - Intronic
1085752914 11:79177725-79177747 ATAAAGGTCCAGAGGTGCAAGGG + Intronic
1086850522 11:91802290-91802312 ATGAAGGACAGGAGAGGCAATGG + Intergenic
1086854447 11:91849511-91849533 ATGAAGCCCAAGAGGGGAACTGG - Intergenic
1088319669 11:108542591-108542613 ATGAGGGCCCAGGTAGGCAATGG + Intronic
1089630515 11:119781373-119781395 AGTGAGGCCCAGAGGGGAAAGGG + Intergenic
1091030012 11:132177745-132177767 ATGAAGCCCCAATGGGGCATGGG + Intronic
1091681590 12:2531411-2531433 ATTGAGGCCCAGAGAGGAAAGGG - Intronic
1094497080 12:30995199-30995221 ATGAAGGCCCTGAGGGCTGAGGG - Exonic
1097035376 12:56120420-56120442 CAGGTGGCCCAGAGGGGCAATGG - Intronic
1097223413 12:57463165-57463187 ATGATGTCCCAGAGAGGCAGAGG - Intronic
1097233166 12:57524149-57524171 GGGAAGCCCCAGAGGAGCAAGGG - Intronic
1097311247 12:58121868-58121890 GTGAAGGCCCAGAGGCCAAAGGG + Intergenic
1098685514 12:73415030-73415052 AAAAGGGCCTAGAGGGGCAAAGG - Intergenic
1100382102 12:94071611-94071633 ATTGAGGCCCAGAGAGGCTAAGG - Intergenic
1100871883 12:98918177-98918199 GTGAAGGGCCTGAGGGGCCATGG - Intronic
1101158705 12:101952259-101952281 ATGAAGGTCCTAAGGGGCCAGGG + Intronic
1101334388 12:103783406-103783428 ATGAAGACCCTGAGGCGCAGAGG - Intronic
1101872446 12:108577182-108577204 AGGAAGCCCCAGTGGGGAAATGG + Intergenic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1103891436 12:124241866-124241888 TTGATGGACCAGAGTGGCAAAGG + Intronic
1103991558 12:124802843-124802865 TTCAAGGCCCAGAAAGGCAAAGG + Intronic
1108256155 13:48612943-48612965 ATGAAGACCCAAAGATGCAAGGG + Intergenic
1111897707 13:94161882-94161904 ATGAAGGCAAGGAGGAGCAAAGG + Intronic
1112833794 13:103488114-103488136 ATGCCGGCCCAGAGGAGCAGGGG - Intergenic
1113822945 13:113228222-113228244 CTGAAGGCCAAGAGGGTCAGTGG - Intronic
1113980949 13:114275244-114275266 ATGAAGGCTGAGAGAGGCGAGGG - Intergenic
1114573931 14:23695427-23695449 ATGATGGCCCAGGGGGACTACGG + Intergenic
1115434685 14:33359270-33359292 AGGAAGGCCTAGAGGGTGAATGG + Intronic
1119742780 14:77025532-77025554 ATCAAGGCCCAGGGGGCCACCGG - Exonic
1119938619 14:78616702-78616724 AAGAGGGCACAGATGGGCAAGGG + Intronic
1121181214 14:91930463-91930485 ACGCAGGCCCAGAGAGGAAATGG - Intronic
1122084737 14:99291728-99291750 ATGATGGCCCAGAGGGTCCTAGG + Intergenic
1122244544 14:100393047-100393069 TTGAAGCCCCAAGGGGGCAAAGG + Intronic
1122436983 14:101706984-101707006 ATGACTGCCCACAGGGGCAGGGG + Intergenic
1122647570 14:103205675-103205697 ATGAAGGCCCATGGGAGGAAGGG + Intergenic
1125794889 15:42396893-42396915 AGGAAGACCCAGAAGGGTAAGGG + Intronic
1125968355 15:43892100-43892122 ATGCAGGCACAGAGGTGAAAGGG + Intronic
1126136972 15:45402273-45402295 GTGAAGGCCGAAAGGGCCAATGG - Intronic
1128071860 15:64802248-64802270 CTGAAGGCCCACACGGGCCAGGG - Intergenic
1128802210 15:70504095-70504117 ACTGAGGCCCAGAGGAGCAAAGG - Intergenic
1129151336 15:73689867-73689889 ATGAAGACCCAGAAAGGCAAGGG + Intronic
1129314101 15:74730875-74730897 GTGAAGCCCCAGGGGGCCAAAGG + Intergenic
1129315716 15:74742505-74742527 CTCAAAGTCCAGAGGGGCAACGG + Intergenic
1129451166 15:75652126-75652148 ACTAAGGCCCAGAGGGGCAAAGG - Intronic
1129721878 15:77882033-77882055 ATGAAGGAGCAGAGGGACCAGGG - Intergenic
1130407052 15:83611645-83611667 CTGCAGGACCACAGGGGCAAGGG + Intronic
1131557884 15:93414990-93415012 CTGCAGGCCCAGAGAGGCAGAGG + Intergenic
1132477622 16:149191-149213 AAGAAGCCCCAGATGAGCAAAGG + Intergenic
1133781327 16:8941435-8941457 AGGAAGGACCTGAGGGGTAAAGG + Intronic
1134043324 16:11084131-11084153 ATGAAGGCCCAGAGCTGAAGGGG - Intronic
1134069736 16:11253680-11253702 GTGGAGGCCCAGGGAGGCAAGGG + Intronic
1134673147 16:16070733-16070755 ATGAAGGGAAAGAGGGACAAGGG - Intronic
1134896006 16:17887260-17887282 ATGAAGACCCAAAGAGTCAAGGG - Intergenic
1135856807 16:26019194-26019216 ATGAATGTCCAGGGGGGCAGTGG + Intronic
1138211314 16:55165452-55165474 ATGAAGGCACAGAGGTGTTAAGG - Intergenic
1138454376 16:57112917-57112939 ACGGAGGCCCAGATGGGGAAAGG + Intronic
1139963192 16:70729615-70729637 ACGAAGGGCCAGAGAGGTAAAGG - Intronic
1141139644 16:81489114-81489136 ATGAAGGCCCAGCTGGTCCAAGG + Intronic
1142136172 16:88453008-88453030 TTGAAGGCCCAGACGGACAGGGG + Intergenic
1142691185 17:1606885-1606907 GTGGAGGCTCCGAGGGGCAAGGG - Intronic
1142973488 17:3629059-3629081 ATGGAGGACCAGAGCTGCAAGGG - Intronic
1143122640 17:4618431-4618453 GAGAAGGCACAGAGGGGAAAGGG + Intergenic
1143294580 17:5861170-5861192 AGGAAGGTCCAGAGGGACAAGGG - Intronic
1144707877 17:17381291-17381313 ATGAAGGGGCAGAGGGGCAGGGG - Intergenic
1146482216 17:33213865-33213887 GAGAATGCCCAGAGGGGCCAGGG - Intronic
1147360750 17:39928048-39928070 AGGAGGGCCCAGCAGGGCAAAGG - Intergenic
1147431177 17:40371706-40371728 AGGAAAGCCCAGAGGTGCAGTGG - Intergenic
1147875201 17:43616152-43616174 ATTGAGGCCCAGAGAGGGAAAGG + Intergenic
1148551025 17:48550878-48550900 AAGAAGGACCAGAAGGCCAAGGG - Exonic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1150824498 17:68462778-68462800 ATGAAGGGACAGAGGAGCAAGGG + Intergenic
1151336518 17:73443164-73443186 AAGGTGGCCCAGAGGGGCAGTGG - Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1151954947 17:77375524-77375546 ATGGAGGCACATGGGGGCAAGGG - Intronic
1152410099 17:80118808-80118830 AAGAGGGCCCAGAGTGGCACAGG + Intergenic
1153551071 18:6262226-6262248 AGGAAGGCGCAGCGGGGAAAGGG + Intronic
1153823905 18:8856982-8857004 ATGAAGGCCAAGGTGGGGAAGGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1155035296 18:22020696-22020718 GTGAAGGCAGAGAGGAGCAAGGG - Intergenic
1155492805 18:26416834-26416856 ATGGAGGCCAGGAGGGGAAACGG + Intergenic
1156304530 18:35864794-35864816 ATGCAGGACCAGATTGGCAATGG + Intergenic
1156987017 18:43360695-43360717 AAGAAGGTCCAGATGAGCAATGG + Intergenic
1157297906 18:46459275-46459297 ACTAAGGCCCAGAGAGACAAAGG - Exonic
1157669425 18:49515784-49515806 AGAAAGGCCCAGAGGCACAAGGG - Intergenic
1158129619 18:54138544-54138566 ATCATGGCTCAGAAGGGCAAAGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1161176429 19:2845108-2845130 ATGGAGGGACAGAGGGGGAAAGG - Intronic
1162460852 19:10813078-10813100 ACTGAGGCCCAGAGAGGCAAGGG - Intronic
1162680353 19:12335856-12335878 ATGAAGACCCAGAGATACAAAGG - Intergenic
1162880531 19:13655544-13655566 ATGAAGACCCAGAGATACAACGG - Intergenic
1162966528 19:14158832-14158854 ATGAAGGCTCAGAGAGGTCAGGG - Intronic
1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG + Exonic
1163689456 19:18730729-18730751 ATAAGGGCCCAGAGGGGGCAGGG - Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165793093 19:38504138-38504160 ACGAAGGCCCAGAGAGACACAGG - Intronic
1166391285 19:42410271-42410293 TTGTGGGCCCAGAGGGGCACGGG + Intronic
1166520057 19:43474326-43474348 ACAAAGGCCCAGAGGTGAAAGGG + Intergenic
1166574605 19:43826054-43826076 ATGAAGTCCCAGATGGGAAACGG + Intronic
1166881451 19:45932916-45932938 CTGAAGGCTCAGAGGAGCAAAGG + Intergenic
925346722 2:3176851-3176873 AGGAAGGCCCAGAGGGGAGAAGG + Intergenic
926281961 2:11456492-11456514 ATAAAGGCCCAGAGAGGCTGAGG - Intronic
927155376 2:20218178-20218200 ACTGAGGCCCAGAGAGGCAATGG + Intronic
929802999 2:45120346-45120368 ATGAGGGCCCAGAGAAGCAAAGG + Intergenic
929977282 2:46647139-46647161 GTGAAGCCCCAGAGGAGAAATGG + Intergenic
930322112 2:49868665-49868687 ATGAAGGCTGAGAGAGGCAAGGG - Intergenic
931437681 2:62262986-62263008 ATGAAGGCCCGGAAGGGCTGCGG - Intergenic
932345739 2:70994329-70994351 ATGAAGGGCCAGAGGCGCAAAGG + Intronic
934159905 2:89238946-89238968 CAGAAGGCCCAGGGAGGCAATGG - Intergenic
934207374 2:89943488-89943510 CAGAAGGCCCAGGGAGGCAATGG + Intergenic
935348872 2:102136341-102136363 ATGATTGCCCTGAGGGACAATGG - Intronic
935890994 2:107677997-107678019 ATCAAGGCCCTGATGGTCAAAGG - Intergenic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
936069034 2:109353266-109353288 ATGCAGGCCCAGGGAGGCAGTGG - Intronic
936258094 2:110934634-110934656 CGGATGGCACAGAGGGGCAATGG + Intronic
937260346 2:120581609-120581631 CTGAAGGCCCAGAAGCTCAAAGG + Intergenic
938369481 2:130760381-130760403 ATGAGGACCCAGGGGGGCGAGGG - Intronic
939026512 2:137020325-137020347 AGAAAGGCCCAGATGGTCAAGGG + Intronic
940307604 2:152243348-152243370 TGGAAGGCCCAGAGGGTTAAGGG - Intergenic
942461516 2:176171723-176171745 AAGAAGGACCAGAAGGCCAAGGG + Exonic
944709628 2:202324097-202324119 ATGAAAAGACAGAGGGGCAAAGG + Intergenic
945034157 2:205689922-205689944 ATGAAGACCCAGAGGGAAATGGG - Intronic
945492674 2:210474945-210474967 ATGCAGGCCCAAATGGCCAAAGG + Intronic
946147967 2:217744974-217744996 ATGAAGGCCCTGAAGGGGACTGG - Intronic
946349876 2:219143133-219143155 ATGAAGGCGCAGGGGGGCCAGGG - Intronic
946461837 2:219875795-219875817 ATGAAGGCCCTTAGAGGCAATGG + Intergenic
946611361 2:221461631-221461653 AACAAGGCCGAGAGGGGGAATGG + Intronic
947545918 2:231010229-231010251 ATGAAGACCCAGAGGTACAGAGG + Intronic
947650500 2:231782109-231782131 ATTGAGGCCCAGAGAGGCGAAGG + Intronic
1169062182 20:2668918-2668940 ATGAAGTCCCAGATAGGAAATGG + Intergenic
1169811187 20:9610928-9610950 AAAAAGGCCAAAAGGGGCAAAGG - Intronic
1170582586 20:17710376-17710398 ATGGAGGCCCGAAGAGGCAAAGG - Intronic
1171987009 20:31667558-31667580 ATGTAGGCCCAGTGTGGCAGAGG - Intronic
1172184543 20:33023200-33023222 ACTGAGGCCCAGAGAGGCAAAGG + Intronic
1172225357 20:33301923-33301945 ATTGAGGTCCAGAGGGGGAAAGG + Intronic
1172750139 20:37245053-37245075 ACCAAGGCCCAGAGAGGTAAAGG - Intergenic
1173064809 20:39700167-39700189 ATGAAGGTCCACATTGGCAAAGG - Intergenic
1173134991 20:40431763-40431785 ATGAAGGATGGGAGGGGCAAGGG - Intergenic
1174191579 20:48744369-48744391 ATAGAGGCTCAGAGAGGCAAAGG + Intronic
1174370473 20:50083790-50083812 AATAAGGCCCAGGGGGGTAAAGG + Intronic
1174558133 20:51411158-51411180 ATCAAGGCTCAGTGAGGCAAAGG + Intronic
1174640707 20:52041499-52041521 ATGAAGGACCACAAGTGCAAAGG + Intergenic
1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG + Intronic
1176409148 21:6438334-6438356 CTGAAGGCACAGGTGGGCAAAGG - Intergenic
1177201652 21:17963454-17963476 CTGAAGGTGAAGAGGGGCAAAGG + Intronic
1178478177 21:32956049-32956071 CTGACAGCCCAGAGGGGGAAAGG + Intergenic
1179730704 21:43365774-43365796 ATGAAGGCCCAGAATGGCCGTGG - Intergenic
1180704493 22:17800753-17800775 ATGCAGGCACAGAGGGGCAAGGG + Intronic
1181163416 22:20970929-20970951 CTTAAGGCCCAAAGGGGCTAAGG + Intronic
1181332123 22:22100937-22100959 ATGATGACCCAGAGGGATAAAGG + Intergenic
1181475270 22:23164203-23164225 CTGGAGGCCCGAAGGGGCAAGGG - Exonic
1181493330 22:23274360-23274382 AGGAAGGCTCAGAGCGGCACAGG - Intronic
1181674440 22:24442541-24442563 ATGAGGGCCCACAGGGGCTATGG + Intergenic
1181830516 22:25556854-25556876 TTGAAGGGCTAAAGGGGCAAGGG + Intergenic
1182015190 22:27033239-27033261 ATAAAGGCCCAGAGAGGAGAAGG + Intergenic
1182121166 22:27787820-27787842 ATGAAGACCCAGATGGGCCCTGG - Intronic
1182421850 22:30252455-30252477 AAGCAGGCCCAGAGGGGCTGAGG + Intergenic
1182484300 22:30630111-30630133 ATGGGAGCCCAGAGGGGCCAGGG - Intergenic
1182547863 22:31085993-31086015 AAAGAGGCCCAGAGGGGCAAGGG - Intronic
1183313413 22:37123993-37124015 ATGCTGGCCCAGAGGGACACTGG + Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1184111540 22:42398355-42398377 ACCAAGGCCCAGAGGGGAACTGG - Intronic
1184391345 22:44205260-44205282 ATCAAGGCTCAGAGGAGCCAAGG - Intronic
1184467652 22:44678235-44678257 AGGAAGGCCCAGAGGAGAGAAGG - Intronic
1184746995 22:46461928-46461950 CTCAAGGCCGTGAGGGGCAAAGG + Intronic
1184868886 22:47220374-47220396 ATGAAGGCCTGGAGGGGGCAGGG - Intergenic
1185190823 22:49434716-49434738 AGTGAAGCCCAGAGGGGCAATGG + Intronic
949242500 3:1889260-1889282 AGGAAAGCCCAGAGGGAAAATGG + Intergenic
949516864 3:4815250-4815272 GTGAAGGCCCAGCGTGGCAGAGG + Intronic
950046130 3:9949573-9949595 ATGAAGGCCAAGAGGGACAGTGG - Exonic
950454150 3:13082782-13082804 ATGAAGGTCAGGAGGGGCAGGGG - Intergenic
950554665 3:13688189-13688211 GTGAAGGCCCGGAGAGGCACAGG + Intergenic
950577514 3:13841652-13841674 TCGAAGGCACAGAGGGGAAAAGG + Intronic
950854377 3:16091632-16091654 AGGAAGCCCCACAGAGGCAAGGG + Intergenic
951904587 3:27691709-27691731 ATGAATGACCAGTGGGTCAATGG + Intergenic
952421529 3:33136026-33136048 ATGTTGGCCCAGAGGAGAAATGG - Intronic
952470815 3:33649624-33649646 CTGAAGGCCTTGTGGGGCAAAGG + Intronic
952478532 3:33735917-33735939 ATGAAGGCTTAGAGGGGCTTTGG - Intergenic
952981900 3:38742861-38742883 ATGAAGGAGGAGAGGGGCAAAGG - Intronic
953225705 3:41017560-41017582 ATGGAGGGACAGAGGAGCAAAGG + Intergenic
954463425 3:50640618-50640640 CTGTAGCCCCTGAGGGGCAATGG + Intronic
955396985 3:58564556-58564578 ATGAAGCCCCAGAGGTAGAAGGG - Intronic
965613190 3:170566084-170566106 TTTAAGGCCCAGAGAAGCAAAGG + Intronic
967106000 3:186255535-186255557 GTGAAGGCCCTGAGGTGCAAGGG + Intronic
967154760 3:186682262-186682284 ATGAAGGCCCAAAGACCCAAGGG + Intergenic
967156349 3:186696063-186696085 ATGAAGGCCCAAAGACCCAAGGG + Intergenic
967674229 3:192277021-192277043 ATGAAGGCCCAAAGAAGCAGGGG - Intronic
968539651 4:1158696-1158718 ATGAAGGCTAAGAGAGGTAAGGG - Intergenic
968922842 4:3531601-3531623 ACGGAGGCCCCGAGGGGAAAGGG - Intronic
969463260 4:7340038-7340060 ATGAAGGGCCTGTGGGGCACTGG + Intronic
970455440 4:16219129-16219151 ACCAAGGCCCAGAGAGGCTAAGG + Intronic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
971419690 4:26464241-26464263 ATAAAGGTCCAGAGAGGGAAAGG - Intergenic
971430943 4:26566621-26566643 ATGAAAGCCCACAGGAGCCAGGG - Intergenic
972456839 4:39263450-39263472 TTGAAGGGGCAGAGGGGCCAGGG - Intronic
973116942 4:46473213-46473235 ATGAAGGCAGAAAGTGGCAAAGG + Intronic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
975109581 4:70608666-70608688 AAGAAGGACCAGCAGGGCAATGG - Intergenic
975627431 4:76363698-76363720 ATGAAGTCAGAGAGGGGCCAAGG + Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976554095 4:86430722-86430744 GTGAAGGCCCTGAGAGGAAAGGG + Intronic
979267566 4:118721051-118721073 ATGAAGGCTCAGAGTGGAGAGGG - Intergenic
980627912 4:135398508-135398530 ATGCAGAGCCAGAGAGGCAATGG + Intergenic
986158540 5:5201233-5201255 ATGACTGCCCAGAAGTGCAAGGG + Intronic
987350674 5:17019092-17019114 ATGTAAGCCCAGAGGTGAAAAGG + Intergenic
990406676 5:55497994-55498016 AAGCAGGTCCACAGGGGCAATGG + Intronic
991029699 5:62069983-62070005 ATCAAGGCCTTGAAGGGCAAGGG + Intergenic
991043689 5:62201149-62201171 AGGAAGGCTCAGCAGGGCAATGG + Intergenic
992049630 5:72930574-72930596 ATCTAGGCCCAGAGGGACCAAGG + Intergenic
997328525 5:133042324-133042346 AGGAAGGCTCAAAGGGGCAAAGG - Intergenic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
998455812 5:142272110-142272132 ATGAAGGCCTAGAGACCCAAAGG - Intergenic
998456150 5:142275087-142275109 ACGAAGGCCCAGAGACCCAAAGG + Intergenic
998960679 5:147483162-147483184 ATTAAGGCCCAGAAAGGTAAAGG + Intronic
999195063 5:149776280-149776302 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1000023467 5:157338829-157338851 ATGGAGGCCCAGAAGGTTAAGGG - Intronic
1001312357 5:170620318-170620340 ATGAAGGCCTAGAGAACCAATGG - Intronic
1002184863 5:177449594-177449616 ATGAAGGCACAGAGAGCCACAGG + Intronic
1002197693 5:177510099-177510121 ATGGAGGCCCAGTGGGGCAGTGG - Intronic
1002459670 5:179367104-179367126 ACCGAGGCCCAGAGGGGCAGGGG - Intergenic
1002833804 6:848490-848512 CTGAACACCCAGAGGGGCAGAGG + Intergenic
1003075793 6:2982880-2982902 GTGACAGCCCACAGGGGCAAAGG + Intergenic
1003282267 6:4704393-4704415 ATGAAGTCCCAGAAAGGTAAAGG + Intergenic
1003476320 6:6487242-6487264 ATGAAGGCCCGGCGAGGCTAAGG - Intergenic
1003922535 6:10846604-10846626 ATGAAGGCCCAGAGTGGCTGGGG + Intronic
1005478375 6:26231493-26231515 ATGAAGGCCCAGAGGTACAGGGG - Intergenic
1005575137 6:27183337-27183359 AGGAAAGCCCAGAGGGGAAGTGG + Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006138522 6:31912487-31912509 ATAAAGGCCTAGAAGGCCAAAGG - Intronic
1007416188 6:41692656-41692678 ATGGAGGCTCAGAGGGGGAGGGG - Intronic
1008253133 6:49265100-49265122 CTGCAGGCCTAGTGGGGCAATGG - Intergenic
1008461503 6:51779287-51779309 ATGAAGGCAGAGGGGGGCAGAGG - Intronic
1008715489 6:54284387-54284409 ATGAAGGCCCATGGGTCCAAAGG + Intergenic
1011221410 6:85058138-85058160 TGGAAGGTCCAGAGGGGGAAAGG - Intergenic
1012152156 6:95768275-95768297 ATGAAGGACCAGAGAGGAAATGG - Intergenic
1013015913 6:106160477-106160499 ATCTAGGCCCAGAGAGGAAATGG - Intergenic
1013295139 6:108752178-108752200 CTGAAGGCCAAGAGGGGAATGGG - Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1017115346 6:150970938-150970960 TTTAAGGCCCAGAGAGGCTAAGG - Intronic
1017154058 6:151307408-151307430 ATGAAAGCCCAGAAGGGAAAAGG + Intronic
1018766788 6:166939987-166940009 ATGGAAGCCCAGAAGGGCCAGGG + Intronic
1019324763 7:432635-432657 ATGGAGCCCCTGAAGGGCAACGG - Intergenic
1019486795 7:1293121-1293143 ATCAAGACCCAGAGGGGCTAAGG - Intergenic
1019534286 7:1520477-1520499 ATGAAGGCCCAAGGGGGAACTGG - Intergenic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1021934067 7:25612911-25612933 ATGAAGGCCAAGAGAGGTGAGGG - Intergenic
1022071961 7:26924864-26924886 ATGAAGGACCAGAGGGCCATAGG - Intronic
1022330731 7:29376348-29376370 AGGAAGCACAAGAGGGGCAAAGG + Intronic
1022600159 7:31750281-31750303 ATGAAGGCCCAAGGAGGCCAAGG + Intergenic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1024157595 7:46640458-46640480 ATCAGGGCACAGACGGGCAAAGG + Intergenic
1024959005 7:54955905-54955927 ATGAAGGCACTGAGTGGGAATGG - Intergenic
1026253078 7:68687647-68687669 TTAAAGGGTCAGAGGGGCAAGGG - Intergenic
1026648656 7:72195215-72195237 AAGAATGCACAGAGGAGCAAGGG - Intronic
1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG + Intergenic
1028912075 7:96219520-96219542 AAACAGGCCCAGAGGGGAAAAGG - Intronic
1034243012 7:149624286-149624308 AGGAAGCCCCGGAGGGGCCAAGG + Intergenic
1034980702 7:155474263-155474285 ACCAAGGCCCAGAGAGGAAAAGG - Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1038621593 8:29148576-29148598 ATGAAGGCCCTGGGCAGCAATGG - Exonic
1038649096 8:29386154-29386176 AGGTAGGCACAGAGGGGAAAGGG - Intergenic
1039333284 8:36562318-36562340 ATGAAGGCCCAAAGATGCAAGGG - Intergenic
1039762015 8:40587057-40587079 ATAGAGGCCCAGAGTGGAAATGG + Intronic
1041626258 8:60030773-60030795 ATGTAGGCCCAGACTGGGAAGGG + Intergenic
1041985260 8:63915336-63915358 ATGAGAACCCAGAAGGGCAAGGG + Intergenic
1043500896 8:80854315-80854337 AGGAAGGCACTGAGGGGAAATGG - Intronic
1045809481 8:106204788-106204810 ATGTAGGCCCAAAGGAGAAAGGG + Intergenic
1046525989 8:115382888-115382910 AAGAATCCCCAGAGGGGAAAGGG + Intergenic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1047965351 8:130042322-130042344 ATGATGCCCCAGAGGAGCCAAGG - Intergenic
1048976572 8:139676311-139676333 ATGATGGCCCAGAAGACCAAGGG - Intronic
1049206416 8:141365687-141365709 ATGAAGGGCCAGAGGTGGGAAGG + Intronic
1049629070 8:143642278-143642300 ATGAAGGCCGAGACGGGTGAGGG - Intronic
1050099457 9:2103000-2103022 ATAAAGGTCCTGAGGGGTAAAGG - Intronic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1054763536 9:69024163-69024185 TTGATGCCCCAGAGGGGAAAGGG + Intergenic
1054813491 9:69453345-69453367 ATGGAGGCCCAGAGACACAAAGG + Intronic
1055647478 9:78374821-78374843 ATGAAGCCCCGGAGAGGCATCGG - Intergenic
1056481260 9:87008768-87008790 ATGATGGCCCATAGGAGCAAAGG + Intergenic
1057199278 9:93131737-93131759 ATGAAGGGCCACAGGGGCGCAGG + Intronic
1057318705 9:93991789-93991811 ATGAAGGCCCAAAGATGCAGGGG + Intergenic
1057847900 9:98539520-98539542 ACTAAGGCCCAGAGAGGGAAGGG - Intronic
1058924697 9:109651356-109651378 ATCAAGTCCCAGAGGAGCAAAGG - Intronic
1059319970 9:113461889-113461911 AGGAAGGCCCACAGGGAAAAGGG - Intronic
1059359014 9:113724846-113724868 TTGAAGGCCTAGAGGGGAAAAGG - Intergenic
1059641742 9:116223855-116223877 AAGAAGGCCCAGAGGATCAGAGG - Intronic
1060003532 9:119980085-119980107 ATGAAAGCACAGAGGGGTTAAGG + Intergenic
1060493223 9:124100112-124100134 ATGAAGGCCTTGAGGGCCTATGG - Intergenic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1060931499 9:127492136-127492158 AAGAAGGCCTGGAGGGGCAGAGG - Intronic
1062207429 9:135344885-135344907 ATGAAGGCCCTGAGGGGTGGTGG - Intronic
1062402970 9:136380497-136380519 ATGACCGCCCAGCGGGGCTATGG + Intronic
1062479249 9:136743865-136743887 CTGAAGACCCAGAGGGGCTCTGG + Intergenic
1062527461 9:136983768-136983790 ATGAAGGTCCAGAGGGACCATGG + Intronic
1186477258 X:9867062-9867084 ATGAAGTCCCATAAGGGCAAGGG - Intronic
1187380055 X:18793778-18793800 AACAAGCCCCAGAGGGGCATGGG - Intronic
1187426446 X:19181583-19181605 ATGAAGGGCAACAGGGGGAATGG + Intergenic
1187955209 X:24511017-24511039 AAGAAGGCACAGAGCGCCAAAGG + Intronic
1188824699 X:34817470-34817492 ATTATTGCCCAGAGGTGCAATGG + Intergenic
1188981731 X:36733048-36733070 ATGAAAGTGCAGAGGGGCTAGGG - Intergenic
1189130548 X:38493835-38493857 GTGAAGTCCCAGAGGAGTAAGGG - Intronic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190946326 X:55097498-55097520 ATGAAGGCTGTGAGTGGCAAAGG - Intronic
1192779899 X:74283338-74283360 TTTAAAGCCCAGAGGGACAAGGG + Intergenic
1195768346 X:108320414-108320436 ATAAAGGAAAAGAGGGGCAAGGG + Intronic
1196809496 X:119617757-119617779 ATGAAGGCCCAGAGAAGGGAAGG - Exonic
1197152789 X:123238322-123238344 ATGGAGGCTCAGAGGGCCTAGGG + Intronic
1197286550 X:124601791-124601813 AGGAAGGACCAATGGGGCAATGG + Intronic
1198835519 X:140800726-140800748 ATCAAGGCCTAGAAAGGCAAAGG - Intergenic
1199881310 X:151975572-151975594 GAGAAGGCACAGAGGGGGAAGGG + Intergenic