ID: 1084467597

View in Genome Browser
Species Human (GRCh38)
Location 11:69335291-69335313
Sequence GAGCCTCGGTGGACACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084467583_1084467597 22 Left 1084467583 11:69335246-69335268 CCCACAGCGTGGCCTGTGCCCAG 0: 1
1: 0
2: 2
3: 28
4: 253
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467587_1084467597 10 Left 1084467587 11:69335258-69335280 CCTGTGCCCAGGGATGCCTTGAT 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467592_1084467597 3 Left 1084467592 11:69335265-69335287 CCAGGGATGCCTTGATGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467593_1084467597 -6 Left 1084467593 11:69335274-69335296 CCTTGATGTGGGGCAAAGAGCCT 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467582_1084467597 23 Left 1084467582 11:69335245-69335267 CCCCACAGCGTGGCCTGTGCCCA 0: 1
1: 0
2: 2
3: 29
4: 472
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467584_1084467597 21 Left 1084467584 11:69335247-69335269 CCACAGCGTGGCCTGTGCCCAGG 0: 1
1: 0
2: 2
3: 46
4: 365
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1084467590_1084467597 4 Left 1084467590 11:69335264-69335286 CCCAGGGATGCCTTGATGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 141
Right 1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084467597 Original CRISPR GAGCCTCGGTGGACACACCT GGG Intronic
900423070 1:2564100-2564122 GTTTCTCGGTGGACACAGCTGGG - Intronic
903828677 1:26162097-26162119 GAGCCGCGGCGGTCACACCTCGG - Exonic
904035854 1:27558180-27558202 GAGCCTGGGTGGGCTAACCTGGG + Intronic
904444362 1:30555950-30555972 GATCCTCTGTGGCAACACCTTGG + Intergenic
904597588 1:31656545-31656567 GAGCTGGGCTGGACACACCTGGG - Intronic
908850922 1:68375008-68375030 GAGCCTCCGTGCACATCCCTTGG - Intergenic
909986947 1:82172854-82172876 GAGCCTAGCTGCACACAGCTGGG + Intergenic
912684132 1:111748798-111748820 GAGCCTCGGTGGTGACACTGAGG - Intronic
914196625 1:145451190-145451212 GAGCCTCCGTGTTCTCACCTGGG - Intergenic
914375710 1:147071956-147071978 GAGCCTAGGTGGGCAGATCTAGG + Intergenic
1067717201 10:48698776-48698798 GAGCCTCGGCGGATACAGCATGG - Intronic
1068318856 10:55383186-55383208 GAGCCTGGCTGGAGACAGCTGGG - Intronic
1073188182 10:101629995-101630017 GAGCCTGGGCTGACACACTTTGG + Intronic
1077135570 11:996534-996556 GAGCCTAGCCGGACAAACCTGGG - Intronic
1077171363 11:1167704-1167726 GTGCCTGGGTGTCCACACCTGGG + Intronic
1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG + Intronic
1078496142 11:11818970-11818992 GAGCCTCAGTGGACCCTGCTAGG + Intergenic
1079433320 11:20419011-20419033 GTGCCTTGGTGCACACATCTGGG + Intronic
1080505873 11:32912832-32912854 GAGCCTGGAAGGTCACACCTAGG + Intronic
1081853037 11:46286973-46286995 GAGCCTGGGAGTACGCACCTGGG - Intronic
1081964573 11:47161689-47161711 GAGGCTGGGTGGGCACACCAAGG - Exonic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1085619022 11:78023292-78023314 GAGCCTCGGTGTTCCCACCTAGG - Exonic
1086415262 11:86582851-86582873 CAGACTCGGTGGAAACAACTGGG - Intronic
1089458466 11:118639284-118639306 GAGCCTCCCAGGACACGCCTTGG - Intronic
1094411428 12:30171443-30171465 TGGCCTCAGTGGAGACACCTTGG - Intergenic
1094787285 12:33863410-33863432 GAGCATCTCTGGACACACCCAGG - Intergenic
1096827653 12:54292211-54292233 AAGCCTCTTTGAACACACCTTGG + Exonic
1100543614 12:95580795-95580817 GAACCAGGGTGGACACACCCTGG - Intergenic
1102815644 12:115863577-115863599 GAGCCTTGGTGTACACACTGTGG - Intergenic
1104724909 12:131070126-131070148 GAGCCTCCCTGGGCACCCCTTGG + Intronic
1108505886 13:51111780-51111802 GGGCCAGGGTGGACACACCAGGG + Intergenic
1111949939 13:94702375-94702397 GCGCATCCGTGGACACACTTAGG + Intergenic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1132674806 16:1117162-1117184 GAGGCTGGGGGGACCCACCTCGG - Intergenic
1134880256 16:17740010-17740032 GATCCACCGTGGACACACCGAGG - Intergenic
1137485093 16:48883942-48883964 GAGTCTCATTGGACTCACCTGGG + Intergenic
1137501145 16:49012730-49012752 GAGCCTTGGCTGACACGCCTGGG - Intergenic
1138578791 16:57926179-57926201 GAGCCTCTGAGAACACACCCTGG + Intronic
1139700715 16:68706447-68706469 GGGCCTTGGAGTACACACCTGGG + Intronic
1140218723 16:73028389-73028411 GAGCCTGCCTGGCCACACCTGGG - Intronic
1141507525 16:84487739-84487761 GAGCGTGGGAGCACACACCTGGG + Intronic
1142027110 16:87820288-87820310 GAGGCTCCGTGGACACACTTAGG - Intergenic
1144044558 17:11443158-11443180 GAGTCTCGAAGGACACCCCTGGG + Intronic
1147690075 17:42309440-42309462 GAGCCTGGGGGCACACAGCTGGG - Exonic
1148038720 17:44689436-44689458 GAGGCTCAGTGGTCTCACCTGGG - Intronic
1148138182 17:45309259-45309281 GTGCCTGGGTGGGAACACCTTGG - Intronic
1152229440 17:79107093-79107115 CAGCCTCTGTGGACAGGCCTGGG - Intronic
1156499273 18:37546822-37546844 GAGGCTTGGTGGACACCTCTGGG - Intronic
1159885434 18:73899147-73899169 CAGGCTGGGTGGACCCACCTGGG - Intergenic
1160233731 18:77068938-77068960 GAGCCTTGGGGGCCTCACCTCGG + Intronic
1160442230 18:78901695-78901717 GAGCCACTGTGGACACACACAGG - Intergenic
1160619733 18:80162420-80162442 CAGCCCCGGTGGTCACAGCTGGG - Intronic
1160622962 18:80183469-80183491 GAGCCTTGGGGGACTCAGCTGGG - Intronic
1160932647 19:1577980-1578002 GGGCCTCGGGGCACACAGCTGGG - Exonic
1163652133 19:18524081-18524103 GAGCCTCTGTGGATTCACTTCGG + Intergenic
1168234535 19:55053756-55053778 GACCCCGGCTGGACACACCTGGG - Intronic
925205195 2:2000174-2000196 GAGCCTCTGTGGCCACAACCTGG + Intronic
925345854 2:3171331-3171353 CTGCCACGGTGGACACACATGGG - Intergenic
926143156 2:10380540-10380562 GGCCCTCTGTGGACACACCATGG - Intronic
926760334 2:16273053-16273075 GAGCCTCCTTGGCCTCACCTGGG - Intergenic
927103708 2:19807022-19807044 GAGCCTCGGAGGACAGATCCAGG + Intergenic
928593572 2:32840275-32840297 GAGCCCGGGTGGACTCACCTGGG - Intergenic
931683922 2:64776793-64776815 GAGCCACGGTTGACATACATGGG - Intergenic
931882459 2:66581752-66581774 GAGCCTCTGCGCTCACACCTGGG - Intergenic
935765003 2:106358290-106358312 GAGCGTCTGTGGTCAGACCTAGG + Intergenic
937915303 2:127095982-127096004 AAGCCTCAGTGTACCCACCTGGG - Intronic
938247651 2:129791493-129791515 GGGCTCCGGTGGACACACCATGG + Intergenic
938420053 2:131138577-131138599 GAGCCTCAGTTGACACCCATGGG + Intronic
944163019 2:196686607-196686629 AAACCTCAGTGGTCACACCTAGG + Intronic
948679757 2:239625819-239625841 GTTCCTCTGTGGTCACACCTAGG + Intergenic
1171234089 20:23510242-23510264 GAGCCTCAGGGCTCACACCTGGG + Intergenic
1174346885 20:49936664-49936686 GAGCCCCGGGGGACACCCCCGGG - Intronic
1175745176 20:61451611-61451633 GAGTCTATGTGGACATACCTAGG + Intronic
1175771056 20:61624572-61624594 AAGCCTCAGTGGCCAAACCTGGG + Intronic
1179657986 21:42857268-42857290 GAGCCCCAGGGGACAGACCTGGG + Intronic
1180930946 22:19591059-19591081 GAGCCTGGCTTCACACACCTGGG + Intergenic
1181646860 22:24236003-24236025 GAGCCTGGATGGACTCACCCAGG - Intronic
1182093120 22:27609442-27609464 GAGCCTCAGTTTCCACACCTGGG - Intergenic
1182424563 22:30265302-30265324 TGGCCTTGGTGGGCACACCTGGG - Intronic
950073540 3:10171173-10171195 GAGCCCCTCTGCACACACCTGGG - Intronic
950423990 3:12914816-12914838 GGGCCTCAGAGGACACACCGGGG + Intronic
953198225 3:40753939-40753961 GGGCCTCGGTGCTCACACTTGGG - Intergenic
955067358 3:55544624-55544646 GATCCTCGCTGGATACTCCTTGG + Intronic
956944145 3:74199724-74199746 GTGCCTAGGTTGACAAACCTTGG - Intergenic
962255034 3:133864801-133864823 GAGACTCGGTGGCCTCACCACGG - Intronic
971384695 4:26132400-26132422 GAGCTCAGGTGGGCACACCTGGG - Intergenic
975746397 4:77479722-77479744 GAACCTCATTGGACAAACCTGGG + Intergenic
982722030 4:158869199-158869221 GGGCCCCGCTGGACACACCTGGG - Exonic
986771207 5:10975642-10975664 GAGCCAAGGTGGCCAAACCTTGG + Intronic
990003974 5:50923679-50923701 CCGCCTCGGTGCCCACACCTGGG + Intergenic
993902460 5:93593877-93593899 GAGACTCAGAGGACCCACCTGGG + Exonic
998161401 5:139814719-139814741 GGGCCTCGGGGGACACCTCTGGG + Intronic
1002159674 5:177307763-177307785 CAGCCTCGGGGCACTCACCTTGG + Exonic
1002617448 5:180464508-180464530 GAGCCTCGCTGGACTCTTCTTGG + Intergenic
1019658155 7:2209016-2209038 GAGCCTGCGTGAACACACGTGGG - Intronic
1019665505 7:2250155-2250177 GAGCCTCGGTGCAGAGACCACGG - Intronic
1023815107 7:43943557-43943579 GTGCCAAGGTGGACACACCCTGG + Intronic
1023984240 7:45085852-45085874 GAGCCTCCGTGGACAGAGCCTGG + Exonic
1024596187 7:50939745-50939767 GAGCCTCCTTGGACTCTCCTGGG - Intergenic
1027996180 7:85427648-85427670 GAGCATATGTGGACCCACCTGGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1033619444 7:143049165-143049187 GGCCCTTGGTGGACACATCTTGG - Intergenic
1035444421 7:158930078-158930100 GAGCCTCGGTGGACATTCACAGG + Intronic
1036709584 8:11069435-11069457 GAGCCTGTGTTGCCACACCTCGG + Intronic
1038624427 8:29177111-29177133 GAGTTTGGGTTGACACACCTGGG + Intronic
1039067012 8:33617675-33617697 GAGCCTGTGGGGGCACACCTAGG + Intergenic
1039617158 8:38965229-38965251 GAGGCTGGGTGAAGACACCTGGG + Intronic
1047288659 8:123509854-123509876 CAGCCTCTGTGGACAGGCCTGGG + Intronic
1048254719 8:132896981-132897003 GAGCCTCTGTGTCCTCACCTGGG + Intronic
1048462156 8:134629896-134629918 GAGCCTGGGTGGTTTCACCTTGG - Intronic
1048974180 8:139661986-139662008 GAGCCCCTCTCGACACACCTTGG - Intronic
1049427948 8:142545623-142545645 GAGCCTATGTGAACACCCCTAGG + Intergenic
1056038721 9:82637487-82637509 CATCCTCGGTGGCCACAGCTTGG - Intergenic
1062698107 9:137885644-137885666 GAGCCTCCGTGTTCTCACCTGGG + Intronic
1190552405 X:51598327-51598349 CAGACTAGGTGGACACACATAGG + Intergenic
1191666224 X:63705616-63705638 GAGGCTGGATGGACAAACCTGGG - Intronic
1192151883 X:68717776-68717798 CATCCTCAGTGGACACACCGGGG + Exonic
1192400321 X:70827773-70827795 GAGCATCTTTGGACACACCTGGG + Intronic
1192982949 X:76366772-76366794 GAGGCTGGGTGCACACTCCTTGG + Intergenic
1195429594 X:104773623-104773645 AAACTTCAGTGGACACACCTGGG + Intronic
1199698963 X:150362882-150362904 GGGCATCGGTGCACTCACCTTGG - Intronic
1200182350 X:154158453-154158475 GAGACTGGGGTGACACACCTTGG - Intronic
1200188004 X:154195567-154195589 GAGACTGGGGTGACACACCTTGG - Intergenic
1200193654 X:154232707-154232729 GAGACTGGGGTGACACACCTTGG - Intronic
1200199409 X:154270511-154270533 GAGACTGGGGTGACACACCTTGG - Intronic