ID: 1084467686

View in Genome Browser
Species Human (GRCh38)
Location 11:69335826-69335848
Sequence AGGGAGGAGACAGTCATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084467686_1084467695 17 Left 1084467686 11:69335826-69335848 CCAACAATGACTGTCTCCTCCCT 0: 1
1: 0
2: 4
3: 27
4: 268
Right 1084467695 11:69335866-69335888 CCCACCAACGCCATGTGGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 134
1084467686_1084467692 12 Left 1084467686 11:69335826-69335848 CCAACAATGACTGTCTCCTCCCT 0: 1
1: 0
2: 4
3: 27
4: 268
Right 1084467692 11:69335861-69335883 ATGTCCCCACCAACGCCATGTGG 0: 1
1: 0
2: 0
3: 1
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084467686 Original CRISPR AGGGAGGAGACAGTCATTGT TGG (reversed) Intronic
900384519 1:2403855-2403877 AGGGAGCAGACTGGCTTTGTAGG + Exonic
902135995 1:14306043-14306065 AGGGAGGAAACAATTTTTGTTGG + Intergenic
903291531 1:22317386-22317408 AGGGCAGAAACAGTGATTGTGGG + Intergenic
903673967 1:25052993-25053015 AGGGAGGAGAAGGGCATTGCAGG - Intergenic
904442327 1:30539833-30539855 AGGGAGGAGACAGACTGTGCTGG - Intergenic
905862056 1:41358366-41358388 AGGGAGGAGACAGTCTCTTGAGG + Intergenic
908994889 1:70139715-70139737 AGGAATGAGACATTAATTGTAGG + Intronic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909597186 1:77419519-77419541 AGGGAAGAAACAGGCATTGTAGG + Intronic
910062353 1:83109188-83109210 AGAGAGAAGTCAGTCATTGGAGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910936880 1:92491287-92491309 AGGGAGGAGACTGTCAGCTTTGG + Intergenic
910959627 1:92747956-92747978 AGGGAAGATACAGTCACTGGAGG - Intronic
911144701 1:94541468-94541490 AGGGAGGCGACAGTCCTGGCTGG - Intronic
911939132 1:104019570-104019592 AGGGAAGAACCAGTCCTTGTAGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
912977188 1:114341444-114341466 TGGCAGGAAACAATCATTGTGGG + Intergenic
913531831 1:119739118-119739140 AGGGAGGAGTCAGGCACTTTGGG - Intronic
914388806 1:147199200-147199222 AGGAAGGAGGCAGGCTTTGTTGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918025486 1:180740865-180740887 AGTGAGGAGACAGTCATCTAGGG - Intronic
918037946 1:180893860-180893882 AGGGAGGAGACAGTAACTATGGG + Intergenic
918276127 1:182955268-182955290 TGGGAGAAGGGAGTCATTGTAGG - Intergenic
919344468 1:196357631-196357653 AGGGAGGAAACAGGCAGGGTGGG + Intronic
920320217 1:205115676-205115698 AGGGAGGAAATAGGCAATGTGGG - Intronic
920846261 1:209595496-209595518 AAGGAGGAGAGGGTCATTGCAGG - Intronic
922022715 1:221720307-221720329 AGGGAGGAGACAGGGACTGAAGG + Intronic
922336790 1:224624548-224624570 AGGGAGGGGACAGACATGGCTGG - Intronic
923822159 1:237457099-237457121 AAGGAGGAGAAAGTCATTCAGGG + Intronic
1063352205 10:5365892-5365914 AGGTAGGAGTTAGCCATTGTAGG - Intronic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1064478394 10:15716044-15716066 GGGGAGGAGAAAGGAATTGTTGG - Intronic
1064939285 10:20714528-20714550 AGTGTGGAGACAGTTATTTTGGG + Intergenic
1065419932 10:25531838-25531860 AGGGAGGAGATGGTCAGAGTGGG + Intronic
1066790231 10:39054288-39054310 AGGTTGGAAACAGTCATTTTGGG + Intergenic
1067746062 10:48937485-48937507 AGGGAGGTGAAATTCATTGTTGG - Intronic
1067928336 10:50534213-50534235 AGAGAGGAGACAGTCAAAGAGGG + Intronic
1068665495 10:59671080-59671102 AGGGAGGGTACAGTCATTTGTGG + Intronic
1068864997 10:61885600-61885622 AGGTAGGAGACACTGGTTGTAGG - Intergenic
1069514337 10:69065664-69065686 ATGTAGGAGACAGTCTTGGTGGG + Intergenic
1070207125 10:74275025-74275047 AGGTGGGAGGCAGACATTGTGGG + Intronic
1071497975 10:86181500-86181522 AAGGAGGAGACAGTCACAGTGGG + Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1072861333 10:99008120-99008142 AGTGAGGAGTCAGTCCTTCTGGG - Intronic
1073001247 10:100287584-100287606 AGGGTGGAGACAGTCAGGGTAGG - Intergenic
1074353858 10:112764044-112764066 ATGTGGGAGACAGTCATTGCAGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1076193998 10:128502306-128502328 TGAGAGGAGACAGTGATTGTAGG - Intergenic
1078640397 11:13090146-13090168 ATAGAGGTGACACTCATTGTTGG - Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079968682 11:27009070-27009092 ATGGAGGAAACAATCATTGTTGG + Intergenic
1083504307 11:63141341-63141363 AGGGAGGAGACAGATTTAGTTGG + Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1085912613 11:80846254-80846276 GAGGAGAAGACAGTCAATGTGGG + Intergenic
1086420694 11:86634308-86634330 AAGGAGAAGACAGTCCTGGTGGG - Intronic
1088028278 11:105214024-105214046 AGGGAGGAGACAGTATTTTTAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089976249 11:122734184-122734206 AGGGAGGAGACATTCAATTTTGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1091091740 11:132777461-132777483 AGGGAGCCCACAGTCATTCTGGG + Intronic
1091393698 12:141058-141080 AGGGAGGAAAGAGTCATGGATGG + Intronic
1091971026 12:4787242-4787264 AGGGAGGAAATAGAAATTGTGGG + Intronic
1093178140 12:15936196-15936218 TAGGAGGAGAGAATCATTGTGGG + Intronic
1094045960 12:26167468-26167490 AAGGAGGAGACAGAAATTGCTGG - Intronic
1094134651 12:27111431-27111453 AGGAAGGAACCATTCATTGTTGG - Intergenic
1097029680 12:56081667-56081689 AGGCAGGAGGCAGGCATGGTTGG + Intronic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099573688 12:84356737-84356759 AGGGAGGAGTGAGTCATAATAGG - Intergenic
1099964366 12:89429699-89429721 AGAGATGAGCCAGGCATTGTGGG - Intronic
1100004097 12:89873462-89873484 AGGGAGGAGTCAATTATTTTGGG + Intergenic
1102162461 12:110780779-110780801 AGGGAGGGGGCAGTCACAGTGGG + Intergenic
1103135089 12:118499909-118499931 AGGGAGGTGTCAGTCTCTGTGGG + Intergenic
1104170244 12:126273599-126273621 AGAGAAGAGACAGTAATTGATGG - Intergenic
1104362782 12:128149573-128149595 AGGGACGAAACAGTCATCGAGGG - Intergenic
1104742896 12:131191853-131191875 AGGGAAGAGCAAGTCAATGTGGG - Intergenic
1104791545 12:131485375-131485397 AGGGAACAGAAAGTCAGTGTTGG + Intergenic
1104823870 12:131694627-131694649 AGGGAGCAGGCACTCTTTGTAGG - Intergenic
1105048574 12:133027748-133027770 AGAGAGGAGCCAGTCACTCTAGG + Intergenic
1107270811 13:38613710-38613732 AGGGAGCAGACAGGAATGGTGGG + Intergenic
1107934355 13:45332499-45332521 ATGGAGGAGAAAGTAATTGAGGG + Intergenic
1108574028 13:51776631-51776653 AGGAAGAAGACAGTTAATGTAGG - Intronic
1111663559 13:91240458-91240480 AGGGAGAAGACATTCAGAGTTGG + Intergenic
1113428762 13:110231114-110231136 GGTGAGGAGACAGTCAGTGTGGG + Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114495551 14:23129260-23129282 TGGGAGGAGGAAGTCATTCTGGG + Intronic
1117480511 14:56139256-56139278 GGGGAGGAGAGAGACCTTGTGGG + Intronic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118633423 14:67726381-67726403 AGGGAGAAGAATGTCATTCTTGG + Intronic
1118839286 14:69499137-69499159 AGGGAAGAGATTGACATTGTGGG + Intronic
1119609860 14:76052521-76052543 AGGGAGGAGACAGACCCTGCAGG + Intronic
1119746409 14:77047593-77047615 AGGGAGAAAACATTCTTTGTAGG - Intergenic
1121242245 14:92439303-92439325 AGAGAGGAGACAGGCAGGGTCGG - Intronic
1122419537 14:101566756-101566778 AGTGAGGAGACAGCCATTGCTGG + Intergenic
1122753544 14:103958380-103958402 AGGGAGTAGACAGTGGGTGTGGG + Intronic
1123136905 14:106036292-106036314 AGGGAAGTCTCAGTCATTGTTGG - Intergenic
1124107494 15:26753729-26753751 AGAAAGGAGACAGTGAATGTGGG + Intronic
1126556683 15:49995899-49995921 AGGAAAGAGACACTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126795448 15:52257294-52257316 AGGGACGAGACAGACATGGCTGG + Intronic
1126908934 15:53398540-53398562 AGGGTGGAGGCAGACGTTGTTGG - Intergenic
1127992591 15:64131825-64131847 AAGGAGGAAGAAGTCATTGTTGG - Exonic
1132571770 16:647386-647408 AGGGAGGAGACGGACATGGTTGG - Intronic
1132623510 16:879339-879361 TGGGAGGAGCCAGTCCTTGGAGG + Intronic
1133831171 16:9324971-9324993 AGGGAGGCTACAGTCCTAGTGGG + Intergenic
1134661477 16:15987746-15987768 AGGGAGGAGACAGTCAGTGCGGG - Intronic
1134684869 16:16151480-16151502 AAGCAGCAGTCAGTCATTGTAGG - Intronic
1135985308 16:27179528-27179550 AGGGAGCAGCCAGTCATGGTAGG + Intergenic
1136279368 16:29198947-29198969 AGGGAGGGGAGGGCCATTGTGGG + Intergenic
1138582062 16:57948141-57948163 AGTGAGGAGACTGTTATGGTGGG - Intronic
1141723046 16:85767539-85767561 AGGGAGGTGACAGTCTGTGGGGG - Intergenic
1142062261 16:88038158-88038180 AGGGGTGGGACGGTCATTGTGGG + Intronic
1142083759 16:88165048-88165070 AGGGAGGGGAGGGCCATTGTGGG + Intergenic
1143570547 17:7755346-7755368 AGGCTGGAGAAGGTCATTGTGGG - Intronic
1144333554 17:14248238-14248260 GGGGTGGAGAAAGTCATTTTAGG + Intergenic
1146457987 17:33021979-33022001 TTGGAGGAGACAGGAATTGTAGG - Intronic
1148934413 17:51153479-51153501 TGGGAGTAGGCAGTCATTCTAGG - Intergenic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1150917042 17:69447786-69447808 AGGGAAGAGACAGTTAATGAAGG + Intronic
1152589428 17:81204123-81204145 AGGGAGGGTCCAGGCATTGTGGG + Intronic
1152720440 17:81921033-81921055 AGGGATGAGGGAGTCACTGTGGG - Exonic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157498495 18:48172839-48172861 AGGGAGGAGACACAGACTGTCGG + Intronic
1158756675 18:60333333-60333355 AGGAAAGATACAGTCATTTTCGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160622665 18:80181603-80181625 GGGGAGGAGACCCTCCTTGTTGG - Intronic
1161250745 19:3279010-3279032 AGGGAGGAGACAGGCCAGGTCGG + Intronic
1161633255 19:5370116-5370138 AGGGAGGTGACAGCCATGGAGGG - Intergenic
1162319046 19:9960053-9960075 AGTGAGGAGGCAGGCATTGGGGG + Exonic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1162666829 19:12220563-12220585 AGGGAGGAGACAGTATTGGGGGG - Intergenic
1163669679 19:18620332-18620354 GGGAAGGAGACAGTCAGGGTTGG + Intronic
1164530016 19:29041514-29041536 AGGGAGGAGGCAGAGTTTGTGGG + Intergenic
1165784098 19:38451030-38451052 AGTTAGGGGACAGTCAGTGTTGG + Intronic
1166826770 19:45614714-45614736 TGGGAGGAGACATTCAGAGTTGG + Intronic
1167126941 19:47555922-47555944 AGGGAGGAGAGAGCCCTTGATGG + Intergenic
1167198905 19:48050364-48050386 AGGGAAGAGAAAGCCATTCTGGG - Intronic
1168116244 19:54222655-54222677 GGGGAGGAGACAGTAGTTCTGGG - Intronic
1168119226 19:54242403-54242425 GGGGAGGAGACAGTAGTTCTGGG - Intronic
925280696 2:2682654-2682676 ATGGAGGACACAGCCATTGGAGG + Intergenic
925335402 2:3095476-3095498 AGGCAGGAGAAAGTCACCGTTGG + Intergenic
929641757 2:43587556-43587578 AGGGATGAGGCAGTGATTGCTGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930826425 2:55700683-55700705 AAGGGGGACACAGTCACTGTGGG - Intergenic
931163408 2:59718853-59718875 AGGGAGAAGATAGCCATTGCAGG - Intergenic
935874725 2:107494453-107494475 GGGAATAAGACAGTCATTGTGGG - Intergenic
936034051 2:109095943-109095965 AGAGAAGAGACAGACTTTGTTGG + Intergenic
937185312 2:120034948-120034970 AAGGAGGAGAAAGTCATTATTGG - Intronic
938582284 2:132657519-132657541 AGGGAAGAGAGAGTCCTTGGTGG + Intronic
939232996 2:139454723-139454745 ACGCAGGAGCCAGTCATGGTAGG + Intergenic
939852386 2:147317485-147317507 AGGGAGGAGGCAATGATTTTTGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942074209 2:172342080-172342102 AGGAAGGAGACACTGCTTGTAGG - Intergenic
943145714 2:184042650-184042672 AGTTAGGAGACAGTCATTTCTGG - Intergenic
943459297 2:188151101-188151123 TAAGAGGAAACAGTCATTGTTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
945664765 2:212726701-212726723 AGGGAGGGGACAAACACTGTGGG + Intergenic
946052492 2:216875432-216875454 AGGGAGGGGACAGGCCATGTGGG + Intergenic
946310055 2:218878268-218878290 AGGGAGGGGAGAGTCTGTGTTGG - Intergenic
947389400 2:229623606-229623628 AGGAAGAAGACAGAAATTGTTGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168941732 20:1718635-1718657 AGGGAGGTGGCAGTCATTGTTGG - Intergenic
1169015800 20:2291758-2291780 GGGGAGAACACAATCATTGTTGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1171219308 20:23380487-23380509 AGGGAGGAGACAATAAGAGTAGG - Intronic
1172119151 20:32587598-32587620 AGGAGGAAGACAGGCATTGTTGG + Intronic
1172520697 20:35563691-35563713 AGGGAGAAAACAGTCTTTATTGG - Intergenic
1172824726 20:37771658-37771680 AGAGAGGAGCCAGTCATTCCTGG - Intronic
1173971953 20:47160065-47160087 AGGGAGGTGATATCCATTGTGGG + Intronic
1175544958 20:59772220-59772242 ATGCAGGAGACTGTCATTGATGG + Intronic
1179209255 21:39312635-39312657 TGGCAGGAAACAGTCATTGGGGG - Intronic
1179877789 21:44279966-44279988 AGGGAGGAGACAGGCAGGGTGGG + Intergenic
1181568365 22:23752945-23752967 GGTGAGGACACAGGCATTGTGGG + Exonic
1182059530 22:27387222-27387244 AGGGAGTTGACATTCATTCTTGG + Intergenic
1183655504 22:39182329-39182351 AGGGAGGAGAGAGACAATGGAGG + Intergenic
1184116864 22:42427258-42427280 AGGGAGGACACAGGCATCCTGGG - Intronic
1184414432 22:44343973-44343995 AGGCAGGAGACAGTGAGTCTTGG - Intergenic
1184692797 22:46124851-46124873 AGGGAGGACCCAGACAGTGTGGG + Intergenic
1185041843 22:48508153-48508175 AGGGAGGTGACTGTCTGTGTGGG + Intronic
1185275347 22:49948224-49948246 GGGCAGGAGACAGTCACTGGGGG - Intergenic
1185371539 22:50463116-50463138 AGGGTGGAGAGAACCATTGTTGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
959037869 3:101386874-101386896 AGGTAGGAGACACTTATTCTGGG - Intronic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
962038899 3:131683959-131683981 GGGGAAGAGACAGTGATTATGGG - Intronic
962902371 3:139772546-139772568 AAGGAGGAGACAGACATGGAAGG + Intergenic
963117300 3:141741345-141741367 ACAGAGGAGATAGTAATTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964455732 3:156863800-156863822 AGTGAAGAGACTGTCATTGGAGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966316975 3:178658193-178658215 AGGGAAGAGACAGCCATCATTGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970550269 4:17173554-17173576 AGGGAGGAGACAGGCAGGGTAGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973740226 4:53912435-53912457 AAGGGGGAGACATTCATTTTGGG - Intronic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977381430 4:96279130-96279152 AGTAATGAGACAGTTATTGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978713048 4:111808899-111808921 AGGTGGGAGATAATCATTGTGGG + Intergenic
978765485 4:112400936-112400958 AGGGAGGTGAGAGTGAGTGTTGG + Intronic
979013250 4:115397372-115397394 AGAGATGAGACAGTCACTGAAGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
983751568 4:171279460-171279482 AGGGAGGAGAAAGGTATTGATGG + Intergenic
983916957 4:173302566-173302588 CCTGAGGATACAGTCATTGTGGG - Intronic
984221300 4:176980446-176980468 AGGGAGGAAAGGGTCATTTTGGG + Intergenic
984770211 4:183430760-183430782 AGGGAGGAGAGAGGCAGTGGGGG - Intergenic
987294363 5:16537046-16537068 AGGGAGGAGGCAGGCAGGGTGGG - Intronic
989000662 5:36756980-36757002 AGGCCTGAAACAGTCATTGTGGG + Intergenic
991302462 5:65142554-65142576 AGGGAGAAGACACTCAATGCTGG + Intergenic
992577843 5:78137394-78137416 AGAAAGGAGAGAGTCAGTGTGGG - Intronic
992642461 5:78779970-78779992 AGGGAGCAGACAGTGATTAATGG - Exonic
993607944 5:90017281-90017303 AGAAAGGAAGCAGTCATTGTTGG - Intergenic
996210945 5:120808926-120808948 AGAGAGGGGACAGTCACTGGAGG - Intergenic
997198020 5:131992495-131992517 AGGGAGGATGCAGTCATTCCAGG + Intronic
997494212 5:134307540-134307562 AGGGAGGCTACTGTCATTCTAGG - Intronic
999157193 5:149466565-149466587 GGGGAAGTGACAGTCATTGCTGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
1002294815 5:178224396-178224418 ACGGAGGTGACATTCACTGTTGG + Intronic
1002455291 5:179342804-179342826 AGGGAGGAGGCTGACATTGGCGG - Intronic
1005250157 6:23936360-23936382 AGGAAGGAGAGAGTCAGAGTTGG - Intergenic
1007013979 6:38444206-38444228 ATGAAGTAGACAGTCATTGAAGG - Intronic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009870881 6:69451248-69451270 AGGGAGGAGCTAGGCACTGTGGG - Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018882814 6:167902343-167902365 TGGGAGGAGATATTCATAGTGGG + Exonic
1019893522 7:3965679-3965701 AGGGAGGAGAAAGGCAGTGAAGG + Intronic
1022370433 7:29765888-29765910 AGAGTGGAGGCAGTAATTGTTGG - Intergenic
1022450597 7:30510518-30510540 AGTGAGGAAACAGGCATAGTAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1025854041 7:65263105-65263127 AGGGAGCTGTCAGTCAATGTGGG + Intergenic
1026977619 7:74508044-74508066 AGGGAGGAGGCAGTGGTGGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029167987 7:98609033-98609055 AGAGAGAAGAAAGTCATAGTTGG + Intergenic
1030677171 7:112396031-112396053 AGGGATGAGACAGACAGTCTCGG - Intergenic
1031144852 7:117986383-117986405 AGGGAGGTAACAGTCATAGTAGG - Intergenic
1031972329 7:128073834-128073856 CGGGATGAGACAGTCAGTGGAGG + Intronic
1032120392 7:129150955-129150977 AAGCAGGAGACAATCATTATTGG + Intronic
1033125451 7:138703042-138703064 AGTGAGGACACAGTCATTGTTGG + Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034168804 7:149046752-149046774 AGGAAGTTGACAGTCTTTGTTGG - Intergenic
1034216811 7:149413943-149413965 AAGGAGGAGAAAGTCAAAGTAGG - Intergenic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1036559286 8:9887927-9887949 AGGGAGGAGAGAGGAAATGTTGG + Intergenic
1038349230 8:26761342-26761364 AGTGAGGAGGGAGTCCTTGTGGG + Intronic
1042499400 8:69492082-69492104 AGTGTGGAGACAGAAATTGTGGG + Intronic
1042665196 8:71196425-71196447 AGGGTGAAGGAAGTCATTGTGGG + Intergenic
1044057616 8:87591160-87591182 AGTAAGGAGAAAGTCATGGTTGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054741607 9:68811505-68811527 ATGGAGAAGACAGTCACTATTGG - Intronic
1055372585 9:75616403-75616425 AGGAAGTATACAGTCTTTGTGGG + Intergenic
1055703727 9:78974788-78974810 ATAAAGGAGACAGACATTGTAGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056535099 9:87519917-87519939 AGGGACGAGGCTGTCACTGTGGG + Intronic
1057318491 9:93989384-93989406 AGGGATTAGACTGTCTTTGTAGG + Intergenic
1058828275 9:108793997-108794019 AGGAAGGATACAGTCATTAAAGG + Intergenic
1059117594 9:111613554-111613576 AGGGAGCTCACAGGCATTGTGGG + Intergenic
1059520756 9:114939622-114939644 AGAGAGGGGATAGTCAATGTGGG + Intergenic
1059667606 9:116463552-116463574 AGAGAGGTGACAGGCATTATAGG - Intronic
1059934952 9:119300562-119300584 AGGGAAGAGACTGACACTGTGGG - Intronic
1059952650 9:119482888-119482910 AGGGATGAGACAGTCTTTTAAGG - Intergenic
1060169107 9:121446192-121446214 AGAGAGGAGCCAATCACTGTGGG - Intergenic
1060482285 9:124023648-124023670 AGTGAGGAGCCAGTCTCTGTTGG + Intronic
1060925507 9:127452505-127452527 AGGGAGAAGATAGTCATGGGAGG - Intronic
1061849692 9:133407131-133407153 TGGGAGGGCTCAGTCATTGTGGG - Intronic
1185776668 X:2808811-2808833 GGGGAGGAGAAAGTGATTGAAGG + Intronic
1186497889 X:10026317-10026339 AGGTATGAGACAGGCATGGTTGG + Intronic
1187125707 X:16452426-16452448 AGGGAGGTGAGAGTCATTCCAGG - Intergenic
1187488843 X:19730576-19730598 AGGGAGGTGACAATCCCTGTGGG - Intronic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1189003110 X:36966139-36966161 AGGATGGAAACATTCATTGTGGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1192230160 X:69259072-69259094 AGGGAGGAGTCAGGGATTCTGGG - Intergenic
1192244868 X:69363684-69363706 AGGGAGCAGACAGTTTCTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195327425 X:103769072-103769094 AGGCAGGAGACAGTCTCAGTAGG + Intergenic
1196462846 X:115947595-115947617 AGGGAGTAGTAAGCCATTGTGGG - Intergenic
1196489444 X:116249327-116249349 AGGGAGGAGGCAATGATTTTTGG - Intergenic
1198047885 X:132920771-132920793 ATGGAGGAGACAATAACTGTAGG + Intronic
1198581045 X:138064592-138064614 AAGGAGGAGAAATTCAGTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199251654 X:145669682-145669704 AGGCAAGAGACAATAATTGTTGG - Intergenic
1200137044 X:153880217-153880239 AGGGAGGAGGCAGTCACTCCAGG - Intronic
1201676224 Y:16587843-16587865 AGAGAGGAAGCAGTCATTCTTGG - Intergenic