ID: 1084470741

View in Genome Browser
Species Human (GRCh38)
Location 11:69357606-69357628
Sequence TGCCACATCCATGGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084470734_1084470741 -8 Left 1084470734 11:69357591-69357613 CCAAGGCAGGGCCTTTGCCACAT 0: 1
1: 0
2: 1
3: 22
4: 185
Right 1084470741 11:69357606-69357628 TGCCACATCCATGGTGGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 197
1084470728_1084470741 23 Left 1084470728 11:69357560-69357582 CCAGCAGAGCAGAGGGTCTGGGG 0: 1
1: 0
2: 3
3: 39
4: 388
Right 1084470741 11:69357606-69357628 TGCCACATCCATGGTGGGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084470741 Original CRISPR TGCCACATCCATGGTGGGGT GGG Intronic
900165222 1:1241808-1241830 TGCCCCATGGAGGGTGGGGTGGG - Intergenic
900665753 1:3814477-3814499 TTCCACATCCATGTTGTGATTGG - Exonic
901130136 1:6957213-6957235 GGCCACATTCAGGCTGGGGTGGG - Intronic
903670194 1:25030970-25030992 AGTCACCTCCATGGTGTGGTGGG - Intergenic
903786244 1:25863132-25863154 TGGATCATCCGTGGTGGGGTCGG + Exonic
903861072 1:26364844-26364866 AGGCATAGCCATGGTGGGGTAGG + Exonic
904612314 1:31732415-31732437 TTCCCCATCCATGGCAGGGTTGG - Intronic
904697636 1:32339198-32339220 TGCCTGATTCATGGTGGGGCCGG - Intergenic
907318487 1:53587960-53587982 TCCCAAATGCATGGTGGGGTCGG - Intronic
907897433 1:58704921-58704943 TGTGACAGCCATGGTGGGGGAGG - Intergenic
908560996 1:65306446-65306468 TGCCACATCACTTTTGGGGTGGG - Intronic
909871399 1:80743766-80743788 AGCCTCATCCAGGGTGGGGATGG - Intergenic
910301763 1:85714026-85714048 TGCCACATATATGGGGGGGAGGG - Intergenic
910392423 1:86758656-86758678 TGCCCCATTGATGGTGGGCTCGG + Intergenic
912422398 1:109552567-109552589 TACCAAATTCATGGTAGGGTAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
914087473 1:144466001-144466023 TGCTACATCCCTGGCTGGGTGGG - Intergenic
924789525 1:247231883-247231905 TGCTACATCTATAGTTGGGTTGG - Intergenic
1063102588 10:2963333-2963355 GGCCACACACCTGGTGGGGTGGG + Intergenic
1063171393 10:3513090-3513112 TGCCTCAGCCATGGTGTGGGAGG - Intergenic
1065583023 10:27190685-27190707 TGACTCATCCATGGTTGGCTTGG - Intergenic
1065972008 10:30812970-30812992 TTCCTCATCCAGGGTCGGGTAGG - Intergenic
1068407246 10:56605585-56605607 TGTCACTTCCACGGTGGGGTGGG - Intergenic
1068764282 10:60745911-60745933 TGCCACAGGCATGGTGGCCTAGG - Intergenic
1069792212 10:71030012-71030034 TGCCATCCCCATGGGGGGGTGGG + Intergenic
1071414985 10:85432927-85432949 AGCCAGATCTATGATGGGGTGGG + Intergenic
1071485686 10:86100885-86100907 TGCCTCATCCAGGCTGGGCTTGG - Intronic
1071888523 10:89977320-89977342 TCCAACAGCCATGGTAGGGTGGG - Intergenic
1073806997 10:107108990-107109012 TCCCACATCCATGGGGGTGATGG + Intronic
1075203776 10:120428743-120428765 TGCGGCATCCATGATGGGGACGG + Intergenic
1076782727 10:132733175-132733197 TGAGACATCCTGGGTGGGGTGGG - Intronic
1080307775 11:30854942-30854964 CTCCACCTCCATGGTGGGATTGG + Intronic
1081623815 11:44634863-44634885 TGACACATCCTGGGTGGGGGAGG + Intergenic
1083944695 11:65917409-65917431 TCCCCCCTCCATGCTGGGGTTGG - Exonic
1084470741 11:69357606-69357628 TGCCACATCCATGGTGGGGTGGG + Intronic
1090397525 11:126429034-126429056 TGCCTCACCTATTGTGGGGTGGG + Intronic
1090853221 11:130588786-130588808 TGTCACATCCCTGGGGGGGATGG - Intergenic
1091518950 12:1216582-1216604 TGACATAGCCTTGGTGGGGTCGG + Intronic
1091837675 12:3597054-3597076 TGTGAATTCCATGGTGGGGTGGG + Intergenic
1094462654 12:30714103-30714125 TGCTAAATGCAAGGTGGGGTTGG + Intronic
1097931352 12:65190330-65190352 TGCCTCATTTATGTTGGGGTTGG + Intronic
1098477564 12:70922296-70922318 TGCCACACGCATGGGGGAGTAGG - Intergenic
1098524690 12:71473188-71473210 TGCCAGATCCATGATGTGCTGGG - Intronic
1099016261 12:77347597-77347619 TGGCACATCCATGGAGGGCATGG - Intergenic
1100272004 12:93034785-93034807 TGCCAAAACCATGGTGAGGCAGG + Intergenic
1101032184 12:100671534-100671556 TGCCAACTCCTTGGTGGGGTTGG + Intergenic
1102525550 12:113510102-113510124 TGCCTCCTCCATCCTGGGGTGGG + Intergenic
1103450285 12:121024095-121024117 TGCCACGTTGAGGGTGGGGTCGG + Exonic
1104678527 12:130732196-130732218 GGCCTCATCCATGGTGTTGTGGG - Intergenic
1107235210 13:38160353-38160375 TGCCACATCCTTGCTCCGGTTGG + Intergenic
1112835820 13:103512953-103512975 TGCCACTTCCATGGTGGGGCAGG + Intergenic
1113023609 13:105916847-105916869 TTCCACAACAATGCTGGGGTAGG - Intergenic
1113289291 13:108886944-108886966 TGCCACATCCTTGATTGTGTGGG + Intronic
1114262512 14:21048202-21048224 TTGCCCATTCATGGTGGGGTGGG - Intronic
1116060652 14:39920518-39920540 TGCCCCATTGATGTTGGGGTTGG + Intergenic
1116617097 14:47153822-47153844 TTCCACAGCCATGGAGAGGTTGG + Intronic
1117037538 14:51743879-51743901 CGTCATATCCATGGTGGGATTGG + Intergenic
1117343864 14:54814203-54814225 TGACACCTCCAAGGTGGAGTGGG + Intergenic
1118037402 14:61882939-61882961 TCTCACATCCAAGGTGGCGTGGG + Intergenic
1120245179 14:81997970-81997992 TCCCACTACCATGGTGGAGTGGG - Intergenic
1122089765 14:99330551-99330573 TGCAAAGTCCATGGCGGGGTGGG - Intergenic
1122105986 14:99455286-99455308 TGCGATATGCATGATGGGGTGGG - Intronic
1122389711 14:101371892-101371914 TGCCAGGTACATGGTGGGGCTGG - Intergenic
1123499241 15:20865745-20865767 TTCCACACCCAGGGTGGTGTGGG + Intronic
1123556476 15:21439364-21439386 TTCCACACCCAGGGTGGTGTGGG + Intronic
1123592717 15:21876710-21876732 TTCCACACCCAGGGTGGTGTGGG + Intergenic
1124959106 15:34381937-34381959 TGCAACATCCCTGTGGGGGTGGG - Intronic
1124975732 15:34528158-34528180 TGCAACATCCCTGTGGGGGTGGG - Intronic
1129688778 15:77701427-77701449 TCCCACCTCCCTGGCGGGGTGGG + Intronic
1129740203 15:77986330-77986352 TGCCCCCTCCATGGCGGGGCAGG + Intronic
1130411260 15:83650568-83650590 TGCCAAAGGCATGGTGTGGTGGG - Intergenic
1131729836 15:95268006-95268028 TGGCACATACATGTTGGGCTGGG - Intergenic
1202964818 15_KI270727v1_random:166553-166575 TTCCACACCCAGGGTGGTGTGGG + Intergenic
1132931601 16:2461613-2461635 GGGCTCATCCTTGGTGGGGTCGG + Intronic
1133221943 16:4322643-4322665 TGCCCCGACCAAGGTGGGGTGGG - Intronic
1133403987 16:5508704-5508726 TGCCATACCCAAGGTGGGGCGGG + Intergenic
1134216681 16:12321830-12321852 TGGGACTTCCTTGGTGGGGTGGG + Intronic
1135062937 16:19286347-19286369 TGTCACAGCCAAGGTGGGGTTGG - Intronic
1136272971 16:29159282-29159304 TGCACCATGCATGGTGGGATGGG + Intergenic
1136272991 16:29159341-29159363 TGTACCATGCATGGTGGGGTGGG + Intergenic
1138524019 16:57591415-57591437 TGCCACATCTATAGTGTGCTAGG - Intronic
1139955760 16:70692296-70692318 AGCCACTTCCGGGGTGGGGTGGG - Intronic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1141299628 16:82801993-82802015 TGTCACCTCCATGGGCGGGTGGG + Intronic
1143439697 17:6959976-6959998 GGCCCCATACATGGTGGGGTGGG - Intronic
1143636238 17:8165117-8165139 AGCCACAGCCTAGGTGGGGTGGG - Intergenic
1145102993 17:20092208-20092230 CCCCACACCCATGGTGGGGTGGG - Intronic
1146944458 17:36864439-36864461 TGCACCATGCAGGGTGGGGTGGG - Intergenic
1147345706 17:39792489-39792511 TGCCAAATGCATGGTGAGGCAGG + Intronic
1147425611 17:40344655-40344677 CCCCACATCCATTCTGGGGTGGG + Intronic
1151826086 17:76525202-76525224 TGCCGCCTCCATCGTCGGGTGGG + Intergenic
1152923198 17:83076161-83076183 GGTCACAGACATGGTGGGGTTGG - Intergenic
1154457284 18:14542499-14542521 TTCCACACCCAGGGTGGTGTGGG + Intronic
1156459381 18:37313114-37313136 TGCACCCTCCATGCTGGGGTGGG + Intronic
1160336729 18:78048360-78048382 GGCCACATTCATGGTGGAGAGGG - Intergenic
1160507281 18:79434236-79434258 AGCCACATCCCTGCCGGGGTAGG + Intronic
1161501490 19:4618456-4618478 TGCCAGATCCACAGTGGCGTGGG - Intergenic
1161793612 19:6374610-6374632 TGGCACATTCTTGGAGGGGTGGG - Intronic
1162348298 19:10134202-10134224 TGCCTCAGGTATGGTGGGGTGGG - Exonic
1162968124 19:14165350-14165372 TGCCACACACCTGGTGGGGGTGG - Intronic
1163172930 19:15545169-15545191 TGCCCCATTCATGCTGGGCTTGG - Intronic
1163422237 19:17220338-17220360 GGCCTCGTCCATTGTGGGGTAGG - Intergenic
926118213 2:10226508-10226530 TGCCACAGCCAAGGTGAGGGTGG - Intergenic
928108893 2:28490588-28490610 TGCCACTGCCACGGTGGGGAAGG + Intronic
928173947 2:29021807-29021829 TGCCCCATCTGTGGTGGGGTGGG - Intronic
931269441 2:60688583-60688605 GGACACAACCATGGTGGTGTGGG - Intergenic
932899459 2:75681459-75681481 ACCCACAGCCCTGGTGGGGTAGG - Intronic
933624799 2:84586247-84586269 TGCCCCTTCCAAGTTGGGGTGGG - Intronic
936047697 2:109199982-109200004 TGTCACAGCTAAGGTGGGGTGGG + Intronic
937234603 2:120423092-120423114 TGCCACGTCCTTGGCGGGTTAGG - Intergenic
938019277 2:127892865-127892887 TCCCACATGCATGGTGTGGTAGG - Intergenic
938247159 2:129786739-129786761 TTCTACATCCAGAGTGGGGTTGG - Intergenic
947040320 2:225911037-225911059 TTTCACATCCATGGGGAGGTGGG + Intergenic
948767366 2:240230135-240230157 TGCCACTGCAATGGTTGGGTCGG + Intergenic
1169203833 20:3729311-3729333 CACCACAACCATGGTGGGGAAGG - Intergenic
1169970678 20:11266427-11266449 TTCCAGATCAATGGTGGTGTTGG - Intergenic
1170873671 20:20231558-20231580 AGCGTCATCCAGGGTGGGGTGGG + Intronic
1173812096 20:45962236-45962258 GGCCACAGGCATGGTGGGGACGG - Intronic
1174102730 20:48139556-48139578 TGCCAAATCCAAGATGGGGATGG - Intergenic
1175001483 20:55633952-55633974 TGCCCCTTCCATATTGGGGTAGG - Intergenic
1175488266 20:59361134-59361156 TCACACAGCCATGGTGGGATTGG + Intergenic
1175769185 20:61612496-61612518 TGCCATATGCATGCTGTGGTTGG + Intronic
1176816875 21:13610854-13610876 TTCCACACCCAGGGTGGTGTGGG - Intronic
1178139268 21:29663765-29663787 TGCAACATCCAGGGTGGAGAGGG + Intronic
1178195294 21:30337924-30337946 TGACTCATTCAAGGTGGGGTTGG + Intergenic
1179284611 21:39966770-39966792 TGCCACAGCCTGGGTGGGATTGG + Intergenic
1181495560 22:23285593-23285615 TGCCACAGCAATGGTCAGGTGGG - Intronic
1182368283 22:29793196-29793218 TGCCCCATTCAGGGTGGGCTGGG + Intronic
1182509132 22:30806592-30806614 TGACTCATCCATGGAGGTGTTGG + Intronic
1182583976 22:31332594-31332616 TTCCACATCAATGCAGGGGTTGG + Intronic
1184055382 22:42044190-42044212 TGGCACATGCCTGGTGGGATAGG - Intronic
1184176535 22:42792436-42792458 TGCCCCCTCCATGGTGGGACAGG - Intergenic
950187568 3:10954509-10954531 AGCTGCATCCATGGTGGGGTGGG - Intergenic
950394202 3:12721219-12721241 TGTCACAACCATGGTGAGGAGGG - Intergenic
951108153 3:18769774-18769796 TGGCAAATCAGTGGTGGGGTTGG - Intergenic
951733463 3:25836649-25836671 AGCCACATCCATGGGGGGACGGG - Intergenic
954289797 3:49643573-49643595 TCCCACATCCAGGGTGGGGTGGG + Intronic
954654565 3:52186123-52186145 TGCCAGATCCAGCCTGGGGTTGG - Intergenic
954683683 3:52359307-52359329 TGCCACCTCCATGGTCCAGTAGG - Exonic
955905123 3:63799215-63799237 TGCCACATCCAGGATGGGACTGG - Intergenic
959335090 3:105054323-105054345 TGCCACATTTTTGGTGGTGTTGG - Intergenic
959431153 3:106256572-106256594 TCCCACCTCCATGCTGGGGCTGG + Intergenic
959863816 3:111243450-111243472 TGCCCCTTCCAAGTTGGGGTGGG - Intronic
961561183 3:127731504-127731526 AGTCCCATCCATGATGGGGTGGG - Intronic
962648745 3:137466734-137466756 GGCCAAAACCAAGGTGGGGTTGG + Intergenic
962741548 3:138365907-138365929 AACCACATACATGGTTGGGTGGG + Intronic
968947628 4:3673912-3673934 TGCCACATCCAGGCTTGGATGGG - Intergenic
969428804 4:7140986-7141008 TGCCTCGTCCTGGGTGGGGTGGG + Intergenic
970614772 4:17758802-17758824 TGGCACATCGATCGTGGTGTTGG + Intronic
971902711 4:32682524-32682546 TGAAACTTCCATGGGGGGGTGGG + Intergenic
972256762 4:37364230-37364252 TGCCACACACATGGTGGAGTGGG - Intronic
976381667 4:84406399-84406421 TGCTACATACCTCGTGGGGTTGG + Intergenic
978203405 4:106049723-106049745 AGCAACATCCTTGGTGGGGGTGG + Intronic
981457573 4:144971771-144971793 TGCCACACCCCTGTTTGGGTTGG + Intronic
984265078 4:177488555-177488577 TGCCCCAACCACGGTGGGATTGG + Intergenic
984705530 4:182844807-182844829 TGCCACATCTGAGGTGGGGAGGG - Intergenic
984750190 4:183264963-183264985 TTCCACATCTATGGAGGGGAGGG - Exonic
990139597 5:52688409-52688431 TGCTATTTCCATGGAGGGGTGGG - Intergenic
992859374 5:80895640-80895662 TGTCAAATGCAGGGTGGGGTGGG - Intergenic
996684627 5:126266803-126266825 TTCCACATCCATGGGATGGTTGG + Intergenic
997210866 5:132075949-132075971 GGCCACAGCCATGGTGGGAGTGG + Exonic
997434072 5:133861584-133861606 TGCCAAAGCCATGGTGGGGGTGG - Intergenic
999191035 5:149747740-149747762 TGCCACATTCCTGTTGGGGCTGG - Intronic
1000231557 5:159320221-159320243 TGCCCCATGCACTGTGGGGTAGG - Intronic
1001426212 5:171624185-171624207 TGCCACAGCCACCCTGGGGTGGG + Intergenic
1001828128 5:174762831-174762853 TGGCACATCCCTGGTGGGGGAGG - Intergenic
1006265719 6:32921511-32921533 TGCCACATATATGCTGGGCTTGG + Intergenic
1006398751 6:33803682-33803704 TGGCACATCCACGGTGGGCCGGG - Intronic
1008662288 6:53680633-53680655 TGCCGCATCCTTGGTGGTTTAGG + Intergenic
1009800749 6:68533672-68533694 TGCAGGACCCATGGTGGGGTTGG - Intergenic
1012211388 6:96522192-96522214 GGCCCCGTCCATGGTGGGGCGGG - Intronic
1013117636 6:107114988-107115010 TGCAACATCCATGCCGGGGTGGG - Intronic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1016618581 6:146080915-146080937 TCCCACACCCACGGTGGAGTGGG + Intronic
1016750300 6:147624326-147624348 TGCCACATCCCCTGGGGGGTGGG - Intronic
1017201709 6:151761699-151761721 TGACCCATCCATGGTGGGGCTGG - Intronic
1017343452 6:153353351-153353373 TTCCTCCTCCCTGGTGGGGTTGG + Intergenic
1019039132 6:169088879-169088901 TGCGGTATCCATGGTGGGGTAGG + Intergenic
1019624983 7:2011436-2011458 CGCCACATCCATGAGGAGGTGGG + Intronic
1020262178 7:6536659-6536681 TGGCCCATCCCTGGTGGGGAGGG + Intronic
1021893967 7:25215909-25215931 TGCTACAGCTAAGGTGGGGTTGG - Intergenic
1023049616 7:36239714-36239736 TTCGGCATGCATGGTGGGGTGGG + Intronic
1024295681 7:47840113-47840135 TGTCACAAAGATGGTGGGGTTGG - Intronic
1024337534 7:48224508-48224530 TGCAACATCCATGTTGCAGTGGG - Intronic
1024701493 7:51908443-51908465 TGCCAAAGTCATGGTGGGGCTGG + Intergenic
1025613827 7:63101075-63101097 TGACACCTCCAAGGTGGAGTGGG - Intergenic
1029743286 7:102503235-102503257 GGCCAGATCCCTGGTGGGGGTGG + Exonic
1029761275 7:102602396-102602418 GGCCAGATCCCTGGTGGGGGTGG + Exonic
1033264705 7:139874735-139874757 TGCTAGATCCATTGTGTGGTGGG - Intronic
1034019477 7:147626329-147626351 TGCCAATTGCATGGGGGGGTGGG + Intronic
1034983989 7:155496381-155496403 GGCCACATCGGGGGTGGGGTGGG + Intronic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1037930588 8:22877881-22877903 CGGCCCCTCCATGGTGGGGTGGG - Intronic
1038059707 8:23899398-23899420 AGCTACATCCGTGGTGGGGGAGG - Intergenic
1039094687 8:33870937-33870959 TGCCACCTCCAAGGTGGGACGGG + Intergenic
1047703218 8:127471406-127471428 GGGCACATCCAAGGTGGGGGTGG - Intergenic
1048374697 8:133812911-133812933 TGCCACCTTCATGGAGGGGTGGG + Intergenic
1048390506 8:133959165-133959187 TGCCAGATCCATGTGGAGGTAGG + Intergenic
1049220227 8:141425612-141425634 TGCGATATCCTTGGGGGGGTGGG + Intronic
1049473048 8:142784731-142784753 TGCCCCTTCCAGGGTGGGGACGG + Intergenic
1052860405 9:33434734-33434756 CCCCACTTCCATGTTGGGGTGGG - Intergenic
1053886115 9:42646033-42646055 TGCAACACCCGTGGTGGGGATGG + Intergenic
1054225137 9:62453482-62453504 TGCAACACCCGTGGTGGGGATGG + Intergenic
1054835535 9:69672129-69672151 TACCACAGCCAGGGAGGGGTGGG - Intronic
1057339786 9:94189553-94189575 TGCCACATAAATGATGGAGTAGG - Intergenic
1058765930 9:108182669-108182691 TGCCTCATCCTGTGTGGGGTTGG - Intergenic
1060051925 9:120383935-120383957 AGCCAAAACAATGGTGGGGTCGG - Intergenic
1061013454 9:127968577-127968599 TGCCACCTTCATGGAAGGGTAGG + Intronic
1061412095 9:130427386-130427408 TCCCACATCCATGCCAGGGTTGG - Intronic
1061639080 9:131937139-131937161 TACCACATCCATCGTGAGGTGGG - Intronic
1062141091 9:134959542-134959564 CGCCACAACCAAGGTGGCGTGGG - Intergenic
1062249839 9:135588541-135588563 GACCAGAGCCATGGTGGGGTGGG + Intergenic
1062549858 9:137080957-137080979 TGCGACAGCCATGCTGGGGAGGG + Intronic
1187098359 X:16169098-16169120 GGCCCCATTCATGGTGGGGTGGG + Intronic
1189059624 X:37738674-37738696 AGCCTCATCCATGGGAGGGTGGG - Intronic
1192174584 X:68877908-68877930 CCTCAGATCCATGGTGGGGTCGG - Intergenic
1192236089 X:69297086-69297108 AGCCCCTTACATGGTGGGGTTGG - Intergenic
1193246772 X:79238746-79238768 GGCCACATCACTGGTGGCGTGGG - Intergenic