ID: 1084473573

View in Genome Browser
Species Human (GRCh38)
Location 11:69376652-69376674
Sequence TGGCACCCCCTTCCCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084473573_1084473591 25 Left 1084473573 11:69376652-69376674 CCCTTCCTGGGAAGGGGGTGCCA No data
Right 1084473591 11:69376700-69376722 CATGCCTTCAGCCCAAAATGGGG No data
1084473573_1084473590 24 Left 1084473573 11:69376652-69376674 CCCTTCCTGGGAAGGGGGTGCCA No data
Right 1084473590 11:69376699-69376721 CCATGCCTTCAGCCCAAAATGGG No data
1084473573_1084473588 23 Left 1084473573 11:69376652-69376674 CCCTTCCTGGGAAGGGGGTGCCA No data
Right 1084473588 11:69376698-69376720 CCCATGCCTTCAGCCCAAAATGG No data
1084473573_1084473584 0 Left 1084473573 11:69376652-69376674 CCCTTCCTGGGAAGGGGGTGCCA No data
Right 1084473584 11:69376675-69376697 GGGGTCTGGGGGTCCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084473573 Original CRISPR TGGCACCCCCTTCCCAGGAA GGG (reversed) Intergenic
No off target data available for this crispr