ID: 1084473934

View in Genome Browser
Species Human (GRCh38)
Location 11:69378195-69378217
Sequence GCAAACCCCCTGGCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084473934_1084473936 -7 Left 1084473934 11:69378195-69378217 CCTGGAGATGCCAGGGGGTTTGC No data
Right 1084473936 11:69378211-69378233 GGTTTGCTTCCCTCGATCACAGG No data
1084473934_1084473942 21 Left 1084473934 11:69378195-69378217 CCTGGAGATGCCAGGGGGTTTGC No data
Right 1084473942 11:69378239-69378261 GCTCCCCTTCCAGGCTCCCAGGG No data
1084473934_1084473939 12 Left 1084473934 11:69378195-69378217 CCTGGAGATGCCAGGGGGTTTGC No data
Right 1084473939 11:69378230-69378252 CAGGCTCCTGCTCCCCTTCCAGG No data
1084473934_1084473941 20 Left 1084473934 11:69378195-69378217 CCTGGAGATGCCAGGGGGTTTGC No data
Right 1084473941 11:69378238-69378260 TGCTCCCCTTCCAGGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084473934 Original CRISPR GCAAACCCCCTGGCATCTCC AGG (reversed) Intergenic
No off target data available for this crispr