ID: 1084476713

View in Genome Browser
Species Human (GRCh38)
Location 11:69393605-69393627
Sequence GTCCATCTGTCTCCCATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084476713_1084476714 -6 Left 1084476713 11:69393605-69393627 CCAGCTATGGGAGACAGATGGAC No data
Right 1084476714 11:69393622-69393644 ATGGACACGTGCCCCTCAGTAGG No data
1084476713_1084476715 -5 Left 1084476713 11:69393605-69393627 CCAGCTATGGGAGACAGATGGAC No data
Right 1084476715 11:69393623-69393645 TGGACACGTGCCCCTCAGTAGGG No data
1084476713_1084476721 28 Left 1084476713 11:69393605-69393627 CCAGCTATGGGAGACAGATGGAC No data
Right 1084476721 11:69393656-69393678 AGCCCAGCTCTACCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084476713 Original CRISPR GTCCATCTGTCTCCCATAGC TGG (reversed) Intergenic
No off target data available for this crispr