ID: 1084478925

View in Genome Browser
Species Human (GRCh38)
Location 11:69405868-69405890
Sequence ATTTCTTTAAAGAAGATGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084478925_1084478929 18 Left 1084478925 11:69405868-69405890 CCGGCCATCTTCTTTAAAGAAAT No data
Right 1084478929 11:69405909-69405931 CCCATTTTGAATTGCATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084478925 Original CRISPR ATTTCTTTAAAGAAGATGGC CGG (reversed) Intergenic
No off target data available for this crispr