ID: 1084480265

View in Genome Browser
Species Human (GRCh38)
Location 11:69415948-69415970
Sequence GGTCCCTGAGGTCCCATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084480253_1084480265 20 Left 1084480253 11:69415905-69415927 CCTCCTAGGCTGAGCTGAGCCCT 0: 1
1: 0
2: 0
3: 27
4: 310
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480252_1084480265 21 Left 1084480252 11:69415904-69415926 CCCTCCTAGGCTGAGCTGAGCCC 0: 1
1: 0
2: 1
3: 27
4: 260
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480260_1084480265 -5 Left 1084480260 11:69415930-69415952 CCAGCTCGCAGCCCAGCGGGTCC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480259_1084480265 -4 Left 1084480259 11:69415929-69415951 CCCAGCTCGCAGCCCAGCGGGTC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480255_1084480265 1 Left 1084480255 11:69415924-69415946 CCCTTCCCAGCTCGCAGCCCAGC 0: 1
1: 0
2: 2
3: 46
4: 434
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480254_1084480265 17 Left 1084480254 11:69415908-69415930 CCTAGGCTGAGCTGAGCCCTTCC 0: 1
1: 0
2: 3
3: 36
4: 284
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144
1084480256_1084480265 0 Left 1084480256 11:69415925-69415947 CCTTCCCAGCTCGCAGCCCAGCG 0: 1
1: 0
2: 1
3: 28
4: 273
Right 1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084480265 Original CRISPR GGTCCCTGAGGTCCCATAGA GGG Intergenic
901384151 1:8896035-8896057 GGTCCCTCAGGTTCCTCAGAGGG - Intergenic
905282240 1:36856599-36856621 GGTACCTGTGGTCCCACAGCTGG - Intronic
908640485 1:66217564-66217586 AGTCCCTTAGGTCACAAAGATGG + Intronic
909540330 1:76784220-76784242 GATCCCAGAGGTCCCATAGCAGG - Intergenic
911104330 1:94118131-94118153 GGTCACTGAGGCTCCAGAGAAGG - Intronic
912361638 1:109100494-109100516 GGTCCCCGAGGTCCCGGAGCTGG + Intergenic
918338254 1:183543784-183543806 AGGCCCTGAGATCCTATAGATGG - Intronic
919905546 1:202075912-202075934 GGTCCCAGGGGTCCCATTTAAGG + Intergenic
1062827570 10:583998-584020 GGTCAGTGAGGTCACAAAGACGG - Intronic
1062896206 10:1105205-1105227 GGTCCCTGAAATCCCAGAGGCGG - Exonic
1064452393 10:15454246-15454268 GCTCCCTGAGGGCCCACAGCAGG - Intergenic
1065683938 10:28265105-28265127 GGTCCCTGAGTTCCCATCAGAGG + Intronic
1067541890 10:47160801-47160823 GGCCCCTGGGGACCCATGGAAGG + Intergenic
1068523902 10:58106435-58106457 GATCCCTGAGGTCCATGAGAAGG - Intergenic
1069769834 10:70891198-70891220 GGTGCCTGAAGCCCCAGAGAGGG + Intergenic
1069907638 10:71741049-71741071 GGTCCCTCAGATCTCATGGATGG + Intronic
1070932541 10:80271535-80271557 GGGCCCTGAGGCCCCAAAAAGGG - Intergenic
1071492261 10:86143936-86143958 GGCCCCTGAGAGCCCAAAGAGGG - Intronic
1073044940 10:100631549-100631571 GGTCTCTGAGGTCCAACAGTGGG - Intergenic
1073070983 10:100793169-100793191 GCTCCCTGAGAGCCCAGAGAAGG + Intronic
1073753153 10:106552471-106552493 GTTCCCTGAGGCCCCTTCGAAGG + Intergenic
1078359903 11:10659958-10659980 GGTCTGTGAGATCCCATAAAGGG + Intronic
1080973007 11:37301782-37301804 GGTCCCTGACTTCCCATAAGAGG + Intergenic
1081806525 11:45893841-45893863 GGTCCCTGAAGGCTCATGGAAGG - Intronic
1082214022 11:49545089-49545111 GATCCTTGAAGTCCGATAGATGG - Intergenic
1083702013 11:64485787-64485809 GCTCCCTGGGGTCCCATGGGTGG + Intergenic
1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG + Intergenic
1085058783 11:73425517-73425539 GGTCACTGTGGTGCTATAGAAGG + Intronic
1091490823 12:931132-931154 AATCCCTGAGGACCCAGAGAGGG + Intronic
1094833517 12:34311611-34311633 GGTCCCTGGGGCCCCACATAGGG + Intergenic
1095639800 12:44475118-44475140 GGTCCCTGATGGAACATAGATGG - Intergenic
1095990859 12:48033592-48033614 GGTCCCTGAGGACCCAGGGGTGG + Intergenic
1097182919 12:57181095-57181117 TGACCCTGAGGTCCCAAGGAGGG + Intronic
1097241895 12:57581338-57581360 GGTCCCTGAGGTCATTTAGCTGG - Intronic
1103561766 12:121796578-121796600 ACTCCCTGAGGTCCCAGGGACGG + Intronic
1106491593 13:30229172-30229194 GGGCCCTGAGGAGCCATAGAAGG - Intronic
1113008502 13:105735814-105735836 GGTCCCTGTGGGTCCTTAGAAGG - Intergenic
1114649704 14:24276683-24276705 GGCCCATGAGGGCCCACAGAAGG + Intergenic
1116541813 14:46109400-46109422 GATCCCTCCAGTCCCATAGAAGG + Intergenic
1118939127 14:70316416-70316438 CTTGCCTGAGGTCCCATAGCTGG - Intergenic
1119382649 14:74239134-74239156 GGTCCCTGAGGTCAGGTGGAAGG - Intergenic
1122038981 14:98968889-98968911 GATCCATGGGGTCCCATAGAAGG + Intergenic
1126169660 15:45684509-45684531 GGCTCCTGAGGTGCCACAGAGGG - Intronic
1128537416 15:68501483-68501505 GGGCCCTGAGTTCCCAGAGATGG + Intergenic
1130302796 15:82692702-82692724 GGTCCCAGAGACTCCATAGATGG + Intronic
1132721164 16:1316379-1316401 CGTCCCTGCCGTCCCATAGCTGG + Intronic
1133172013 16:3987441-3987463 GGTGGCTGTGGTCCCATAGCCGG - Intronic
1136737206 16:32475677-32475699 GCTCCCTGGGGTCCCCTGGAAGG - Intergenic
1141686251 16:85571618-85571640 GGTCCCTGTGGCCCCAAACACGG - Intergenic
1141709613 16:85690170-85690192 CCTCCCTGAAGCCCCATAGAGGG + Intronic
1141755464 16:85987813-85987835 GGTCCTAGAGGTCCCAGAGGAGG - Intergenic
1142259148 16:89034498-89034520 GCTCTCTGAGGTCCGATGGAGGG + Intergenic
1203015864 16_KI270728v1_random:353900-353922 GCTCCCTGGGGTCCCCTGGAAGG + Intergenic
1203034199 16_KI270728v1_random:627058-627080 GCTCCCTGGGGTCCCCTGGAAGG + Intergenic
1143635471 17:8161988-8162010 AGCGCCTGAGGTTCCATAGAGGG - Intronic
1148090306 17:45019312-45019334 GGTCCCTGCGGCCCGATCGATGG + Intergenic
1148862150 17:50610034-50610056 GGTCCCTGGGGCCCCCAAGAGGG + Intronic
1149329490 17:55566778-55566800 GCTCCCTGAGGTCTCACTGAGGG + Intergenic
1151387908 17:73766534-73766556 GGACCCTGAGGTCCATTACAGGG + Intergenic
1152169484 17:78734919-78734941 GGTCCCTGAGATCCCAGGGGAGG - Intronic
1153479817 18:5535920-5535942 GGTCACTGGGCTCCCAGAGATGG - Intronic
1156834715 18:41538835-41538857 GAACCCTTAGGTCCCATGGATGG + Intergenic
1161354319 19:3810589-3810611 AGTCCCTGAGGTCCCCTTGCGGG - Intronic
1161843142 19:6694395-6694417 GGTCCCTGGGGTCTCCAAGAGGG + Intronic
1162147237 19:8620423-8620445 GGTCCCTGAGGCCACATGGAGGG + Intergenic
1163271720 19:16258566-16258588 TGTCCCTGAGGTCACAGATAAGG + Intergenic
1163402287 19:17101460-17101482 GGAGCCTGAGGTCACATTGAAGG + Intronic
1164857870 19:31538964-31538986 GGTCCCTAGGGTCCCCCAGAAGG - Intergenic
1168545081 19:57243447-57243469 GGTCCCTGAGGTCACAAAACTGG + Intronic
1168549874 19:57283874-57283896 GGTCCCCAAGGTCACATAGCAGG + Intronic
925741079 2:7006631-7006653 GGTCCCAGAGGTCCCAGTGAGGG - Intronic
927488259 2:23504002-23504024 GGTCCCTGAGGGCCAAGACAGGG + Intronic
931201889 2:60105683-60105705 AGTACCTGTGTTCCCATAGATGG - Intergenic
932301409 2:70669833-70669855 GGGCCCTGAGACCACATAGAGGG + Intronic
934188340 2:89764792-89764814 GCTCCCTGGGGTCCCCTGGAAGG - Intergenic
934308261 2:91843163-91843185 GCTCCCTGGGGTCCCCTGGAAGG + Intergenic
934608940 2:95720344-95720366 GATCCCAGAGGTCCCATGTAAGG + Intergenic
934620252 2:95799207-95799229 TGTCCCCGAGGTACCACAGAGGG - Intergenic
934777676 2:96949546-96949568 GGTTCCTGAGGTCCCAGGGTAGG - Intronic
936542245 2:113361810-113361832 GATCCCGGAGGTCCCATGTAAGG + Intergenic
936824442 2:116563985-116564007 GGTACCTCAGGACCCACAGAGGG - Intergenic
944671983 2:202002539-202002561 GGTGACTGAGGTCCCAGAGCCGG + Intergenic
948723471 2:239918136-239918158 GGTCCCTCAGGCCCCAGAGCAGG - Intronic
1169630560 20:7626078-7626100 GGACCCTGAGGTTGCAGAGAGGG - Intergenic
1175168991 20:57066752-57066774 GGTTCCTGGGGTCCCAGGGATGG + Intergenic
1175248300 20:57594331-57594353 GGTCCCCGAGGTCCCATCCAGGG - Intergenic
1176051597 20:63122586-63122608 GGTCCCTGTGGTCACATTCATGG + Intergenic
1176249403 20:64113145-64113167 GCGCCCTGAGCCCCCATAGAGGG + Intergenic
1176412636 21:6457369-6457391 GATCCCTGAGGGCACACAGAGGG + Intergenic
1177338115 21:19760024-19760046 GGTCCCCGGGGTCCCAGAGATGG - Intergenic
1178051012 21:28747304-28747326 GCTCCATGAGGTCCAATAGCTGG - Intergenic
1179269594 21:39840512-39840534 GGCCCCTGAGCTCCCCTACAAGG + Intergenic
1179479714 21:41669499-41669521 GGTCCCGGAGGTCCCCGAGCCGG - Intergenic
1179688130 21:43065691-43065713 GATCCCTGAGGGCACACAGAGGG + Exonic
1180535345 22:16390242-16390264 GCTCCCTGGGGTCCCCTGGAAGG + Intergenic
1181509307 22:23381912-23381934 GGTTCCTGAGGTCACACAGCAGG - Intergenic
1181782815 22:25205350-25205372 GGTCCCTTACGTCCCGTTGATGG - Exonic
1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG + Intronic
1182846518 22:33435579-33435601 GGTGCCTGAGTTCCCAGAGCTGG - Intronic
1185275409 22:49948423-49948445 GGTTCCCGTGGTCCCCTAGAGGG + Intergenic
949407910 3:3734026-3734048 GGGCTCTGAGGTGCCATAGCAGG + Intronic
949840831 3:8318022-8318044 GGTACCTGAGGCGCCTTAGAAGG - Intergenic
950725653 3:14915195-14915217 GGTTCCTGAGGTCCCATGGAGGG + Intronic
950807634 3:15620783-15620805 GGTCCCTGACTTCCCATAACAGG + Intronic
952148432 3:30559353-30559375 TGTTCCTCAGGTCCCATTGAAGG - Intergenic
955091091 3:55751346-55751368 GGTCACTGAAGACCCCTAGAAGG - Intronic
957165979 3:76674479-76674501 GGACCCTGAGTTCCAATTGACGG + Intronic
957254272 3:77816376-77816398 GTTTTCTGAGGTCCCATAGCCGG + Intergenic
961451470 3:127004140-127004162 CGTCCCTGAGGTCCCCAGGAAGG - Intronic
962849143 3:139294948-139294970 GGTCCTTGGGGTACCAAAGATGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
963065951 3:141264741-141264763 GTTGCCTGAGGTCACATAGCTGG - Intronic
964815287 3:160710743-160710765 GGTCCCAAAGATCCCAGAGAGGG + Intergenic
967185351 3:186939914-186939936 GGACCCTGTCTTCCCATAGATGG - Intronic
969720602 4:8891349-8891371 GGTCCCTGAGACCCCAGCGACGG - Intergenic
974313053 4:60238009-60238031 GATCCCTGAGGTACAAAAGAGGG - Intergenic
980278370 4:130684899-130684921 GGTCCCTAGGATCCCACAGAAGG + Intergenic
984602588 4:181745531-181745553 GTTCCCTGAGGTCCATGAGAGGG + Intergenic
992388989 5:76313027-76313049 TGTCCCTGAGGTCGCACAGCTGG - Intronic
992628611 5:78658684-78658706 GGGCCCTGAGGAGCCATTGAGGG + Intronic
997201165 5:132011096-132011118 GGTCCCCGAGGTCCCACAGCAGG - Intronic
997512226 5:134461585-134461607 GGTCCCTCAGGCCCCAGAGGAGG - Intergenic
999270960 5:150296169-150296191 TGTGCCTGAGGTCACATAGTGGG + Intergenic
1004456223 6:15793968-15793990 GGTCCCTGAGCTCATCTAGATGG - Intergenic
1006782853 6:36643800-36643822 GCTGCCTGAGGTCACACAGAGGG - Intergenic
1007260676 6:40561084-40561106 TGTCTCTGAGGTCCCATTGAAGG - Intronic
1014689548 6:124546269-124546291 GGTCCCTCAGTTCCCAAACATGG + Intronic
1021537516 7:21722304-21722326 AGGCCCTGAGGTACCATGGAAGG - Intronic
1024004125 7:45212785-45212807 GGGCACTGAGGTGCCATGGATGG - Intergenic
1027255172 7:76426353-76426375 AGTTCCTGTGGTCCCATGGAGGG + Intronic
1028614349 7:92748772-92748794 GCTTCCTGAGGCCCCATGGAAGG + Intronic
1032144367 7:129365804-129365826 GGTGCCTGAGGTTTCATATATGG + Intronic
1037457740 8:19081050-19081072 GTTCCCTGGGTTCCCACAGAGGG + Intronic
1037986820 8:23295390-23295412 GAGCCCTGAGGGCACATAGAAGG + Intronic
1040071258 8:43190571-43190593 GGACCCTCAGGTCCCACAGAAGG - Intronic
1041011498 8:53548096-53548118 GGTGCCTCAGGGCCCATCGAGGG + Intergenic
1046492765 8:114974634-114974656 GGTCTCTGAGGAGCCAAAGATGG - Intergenic
1047331795 8:123896027-123896049 GGTCCTTGGGGTCAAATAGAGGG + Intronic
1050341190 9:4640505-4640527 GGTCCCTGAGAACCCAAATATGG + Intronic
1053293491 9:36897372-36897394 GGTCCCTGAGGTCCCCCTGGAGG - Intronic
1056047301 9:82732510-82732532 CCTGCCTGGGGTCCCATAGAGGG + Intergenic
1057008116 9:91578542-91578564 GGTCTCTGATGTCTCCTAGATGG - Intronic
1058419716 9:104822085-104822107 GGTCCTTGAGGTCGCAGGGAAGG + Intronic
1060911656 9:127355990-127356012 GGGCCCTGAGGTCCTGTTGAAGG + Intronic
1061362923 9:130155179-130155201 GGCTCCTGAGGTTCCACAGATGG - Intergenic
1062082670 9:134632640-134632662 GGTCCCCAAGGCCCCATGGATGG + Intergenic
1062363164 9:136197155-136197177 GGTCCCTCAGCCCCCAGAGAGGG + Exonic
1191837840 X:65484153-65484175 GGTCTTTGAGGACACATAGAGGG + Intronic
1197671741 X:129284839-129284861 GGTCCCTGTGGTGCCAGGGAGGG + Intergenic
1200111470 X:153743093-153743115 GCTCCCTGGGGTCCCCTGGAAGG + Intronic
1200838162 Y:7753165-7753187 GGTCCCTGACTTCCCATAACAGG - Intergenic
1201791674 Y:17848157-17848179 GGTCCCTGTGGTCACTTAGATGG - Intergenic
1201799592 Y:17940742-17940764 GGTGCCTGTGGTCACTTAGATGG - Intergenic
1201801961 Y:17965214-17965236 GGTGCCTGTGGTCACTTAGATGG + Intergenic
1201809880 Y:18057832-18057854 GGTCCCTGTGGTCACTTAGATGG + Intergenic
1202353280 Y:24017809-24017831 GGTCCCTGTGGTCACTTAGATGG - Intergenic
1202361946 Y:24119869-24119891 GGTCCCTGTGGTCATTTAGATGG + Intergenic
1202363127 Y:24133227-24133249 GGTCCCTGTGGTCATTTAGATGG - Intergenic
1202507652 Y:25536890-25536912 GGTCCCTGTGGTCATTTAGATGG + Intergenic
1202508832 Y:25550244-25550266 GGTCCCTGTGGTCATTTAGATGG - Intergenic
1202517499 Y:25652306-25652328 GGTCCCTGTGGTCACTTAGATGG + Intergenic