ID: 1084480862

View in Genome Browser
Species Human (GRCh38)
Location 11:69419257-69419279
Sequence CTCACGGCCCTGAACACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084480850_1084480862 28 Left 1084480850 11:69419206-69419228 CCACTCCAGGGTTGAGGCAGAGT No data
Right 1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG No data
1084480858_1084480862 -1 Left 1084480858 11:69419235-69419257 CCAAGGGGTGGTTGTGCCCTGGC No data
Right 1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG No data
1084480851_1084480862 23 Left 1084480851 11:69419211-69419233 CCAGGGTTGAGGCAGAGTGTGCT No data
Right 1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG No data
1084480856_1084480862 0 Left 1084480856 11:69419234-69419256 CCCAAGGGGTGGTTGTGCCCTGG No data
Right 1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084480862 Original CRISPR CTCACGGCCCTGAACACAGT AGG Intergenic
No off target data available for this crispr