ID: 1084481134

View in Genome Browser
Species Human (GRCh38)
Location 11:69420831-69420853
Sequence GGCCCACATCCCCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084481134_1084481143 21 Left 1084481134 11:69420831-69420853 CCAGGCCTGTGGGGATGTGGGCC No data
Right 1084481143 11:69420875-69420897 CCAGACCCTCTGTCTCAGCGAGG No data
1084481134_1084481138 -9 Left 1084481134 11:69420831-69420853 CCAGGCCTGTGGGGATGTGGGCC No data
Right 1084481138 11:69420845-69420867 ATGTGGGCCCAGTGGGTGAGTGG No data
1084481134_1084481146 30 Left 1084481134 11:69420831-69420853 CCAGGCCTGTGGGGATGTGGGCC No data
Right 1084481146 11:69420884-69420906 CTGTCTCAGCGAGGCATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084481134 Original CRISPR GGCCCACATCCCCACAGGCC TGG (reversed) Intergenic
No off target data available for this crispr