ID: 1084484056

View in Genome Browser
Species Human (GRCh38)
Location 11:69437885-69437907
Sequence GCCCCCCAGACCCACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084484056_1084484061 11 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484061 11:69437919-69437941 GCCCTTCCTTTGAAGACAAGGGG No data
1084484056_1084484059 9 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484059 11:69437917-69437939 ACGCCCTTCCTTTGAAGACAAGG No data
1084484056_1084484073 30 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484073 11:69437938-69437960 GGGGCCAACGGGGGTGGGGAGGG No data
1084484056_1084484070 25 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484070 11:69437933-69437955 GACAAGGGGCCAACGGGGGTGGG No data
1084484056_1084484069 24 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484069 11:69437932-69437954 AGACAAGGGGCCAACGGGGGTGG No data
1084484056_1084484068 21 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484068 11:69437929-69437951 TGAAGACAAGGGGCCAACGGGGG No data
1084484056_1084484060 10 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484060 11:69437918-69437940 CGCCCTTCCTTTGAAGACAAGGG No data
1084484056_1084484066 19 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484066 11:69437927-69437949 TTTGAAGACAAGGGGCCAACGGG No data
1084484056_1084484071 26 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484071 11:69437934-69437956 ACAAGGGGCCAACGGGGGTGGGG No data
1084484056_1084484065 18 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484065 11:69437926-69437948 CTTTGAAGACAAGGGGCCAACGG No data
1084484056_1084484067 20 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484067 11:69437928-69437950 TTGAAGACAAGGGGCCAACGGGG No data
1084484056_1084484072 29 Left 1084484056 11:69437885-69437907 CCCTCAGGGTGGGTCTGGGGGGC No data
Right 1084484072 11:69437937-69437959 AGGGGCCAACGGGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084484056 Original CRISPR GCCCCCCAGACCCACCCTGA GGG (reversed) Intergenic
No off target data available for this crispr