ID: 1084484085

View in Genome Browser
Species Human (GRCh38)
Location 11:69437987-69438009
Sequence GGCCCCAGTGCAGCAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084484085_1084484091 8 Left 1084484085 11:69437987-69438009 CCCTCTCTTGCTGCACTGGGGCC No data
Right 1084484091 11:69438018-69438040 TGCCTTTCCTCATACAAACCAGG No data
1084484085_1084484095 30 Left 1084484085 11:69437987-69438009 CCCTCTCTTGCTGCACTGGGGCC No data
Right 1084484095 11:69438040-69438062 GTTGTACAGCCTGATCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084484085 Original CRISPR GGCCCCAGTGCAGCAAGAGA GGG (reversed) Intergenic
No off target data available for this crispr