ID: 1084486441

View in Genome Browser
Species Human (GRCh38)
Location 11:69450936-69450958
Sequence GGCTGTGTTTGGAAGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084486441_1084486452 11 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486452 11:69450970-69450992 TGCACACAACCTTGCTTCTGGGG No data
1084486441_1084486451 10 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486451 11:69450969-69450991 ATGCACACAACCTTGCTTCTGGG No data
1084486441_1084486450 9 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486450 11:69450968-69450990 CATGCACACAACCTTGCTTCTGG No data
1084486441_1084486453 12 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486453 11:69450971-69450993 GCACACAACCTTGCTTCTGGGGG No data
1084486441_1084486454 18 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486454 11:69450977-69450999 AACCTTGCTTCTGGGGGAATAGG No data
1084486441_1084486456 25 Left 1084486441 11:69450936-69450958 CCATCAGCCTTCCAAACACAGCC No data
Right 1084486456 11:69450984-69451006 CTTCTGGGGGAATAGGACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084486441 Original CRISPR GGCTGTGTTTGGAAGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr