ID: 1084488658

View in Genome Browser
Species Human (GRCh38)
Location 11:69465738-69465760
Sequence CTGGGCATGAAAAGTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084488647_1084488658 11 Left 1084488647 11:69465704-69465726 CCCCAGTTCTGACCTAATCTGTC No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data
1084488645_1084488658 15 Left 1084488645 11:69465700-69465722 CCACCCCCAGTTCTGACCTAATC No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data
1084488649_1084488658 9 Left 1084488649 11:69465706-69465728 CCAGTTCTGACCTAATCTGTCCG No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data
1084488654_1084488658 -1 Left 1084488654 11:69465716-69465738 CCTAATCTGTCCGGGGTGCGGTC No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data
1084488648_1084488658 10 Left 1084488648 11:69465705-69465727 CCCAGTTCTGACCTAATCTGTCC No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data
1084488646_1084488658 12 Left 1084488646 11:69465703-69465725 CCCCCAGTTCTGACCTAATCTGT No data
Right 1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084488658 Original CRISPR CTGGGCATGAAAAGTTTTTC AGG Intergenic
No off target data available for this crispr