ID: 1084488721

View in Genome Browser
Species Human (GRCh38)
Location 11:69466009-69466031
Sequence CCCACCCACATTATTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084488721_1084488723 13 Left 1084488721 11:69466009-69466031 CCTCAAAAAATAATGTGGGTGGG No data
Right 1084488723 11:69466045-69466067 CGCCAGTTATATAAGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084488721 Original CRISPR CCCACCCACATTATTTTTTG AGG (reversed) Intergenic
No off target data available for this crispr