ID: 1084488723

View in Genome Browser
Species Human (GRCh38)
Location 11:69466045-69466067
Sequence CGCCAGTTATATAAGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084488716_1084488723 30 Left 1084488716 11:69465992-69466014 CCATCAGCCATGGGGGTCCTCAA No data
Right 1084488723 11:69466045-69466067 CGCCAGTTATATAAGTGATCTGG No data
1084488721_1084488723 13 Left 1084488721 11:69466009-69466031 CCTCAAAAAATAATGTGGGTGGG No data
Right 1084488723 11:69466045-69466067 CGCCAGTTATATAAGTGATCTGG No data
1084488717_1084488723 23 Left 1084488717 11:69465999-69466021 CCATGGGGGTCCTCAAAAAATAA No data
Right 1084488723 11:69466045-69466067 CGCCAGTTATATAAGTGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084488723 Original CRISPR CGCCAGTTATATAAGTGATC TGG Intergenic
No off target data available for this crispr